Echiniscus succineus, Gasiorek, Piotr & Voncina, Katarzyna, 2019

Gasiorek, Piotr & Voncina, Katarzyna, 2019, New Echiniscidae (Heterotardigrada) from Amber Mountain (Northern Madagascar), Evolutionary Systematics 3 (1), pp. 29-39 : 29-34

Echiniscus succineus sp. nov. Figs 2, 3, 4, 5, Tables 2, 3

Material examined.

Holotype (adult female on the slide MG.005.05) and sixteen paratypes (slides MG.005.04-7, including two voucher exoskeletons preserved after DNA extraction on the slides MG.005.28-29 and two specimens on the SEM stub no. 17.11). Except for two paratypes (slide MG.005.04) deposited in the Natural History Museum of Denmark, University of Copenhagen, the entire type series deposited in the Institute of Zoology and Biomedical Research, Jagiellonian University, Poland.

Locus typicus.

Lowland rainforest close to the road from Joffreville (Diana Region, Antsiranana Province, Northern Madgascar); coordinates and altitude: 12°30'49"S, 49°10'56"E; 993 m asl. Substratum: moss growing on a tree branch (ca. two metres above ground level); collection: December 2018 by W. Witaliński.

Diagnosis.

Small representative of the Echiniscus spinulosus group with peculiarly complex dorsal plate sculpturing developed as thick epicuticular ridges on scapular, paired segmental and caudal plates. Spines in almost all lateral and dorsal trunk positions. Parthenogenetic.

Description.

Adult females and juveniles. Body dark yellow and plump. Red eyes present, dissolved after mounting. External cirri not markedly longer than internal cirri, with swollen cirrophores (Fig. 3C). Primary and secondary clavae (cephalic papillae) of similar lengths. Cirrus A short (cirrus A/body length ratio below 20%), with short and poorly marked cirrophore. Trunk appendage configuration (B)-C-Cd-D-Dd-E in adults (Figs 2, 3 A–B), reduced to (Cd)-Dd-E in juveniles. All appendages in form of spines of similar lengths, spines Dd and E more robust, and sometimes gently serrated or rough (Figs 3 A–B). Asymmetry in the development of appendages frequent, one of the spines B almost always absent, more rarely one of the spines C and D absent. Dorsal plates with rather irregularly distributed, large to very large pores ( spinulosus type; Figs 2, 3). Dark endocuticular rings variously developed: from barely visible on the central portions of median plates (Fig. 3A) to well-developed rings present in pores from different plates (Figs 3B, 4A); they are the elements of sponge-like endocuticular layer visible under SEM (Fig. 3D, 4B). The level of development of the rings is not associated with life stage, and some individuals do not exhibit intraporal rings. Cephalic plate large, halved, with scarce and minute pores (Figs 2, 3 A–C). Cervical (neck) plate present, poreless and developed as grey rectangular belt adjacent to the anterior margin of the scapular plate (Fig. 3 A–C). Scapular plate with the system of thick epicuticular extensions, dividing its surface into clearly defined areas of thinner cuticle, being lighter under PCM and slightly concave under SEM (Fig. 3 A–C). Median plates I–III large and uniformly dark under PCM, the first and the third plate are unipartite, whereas the second one is bipartite, with its anterior portion being a poorly developed, narrow triangle (Figs 2, 3 A–B). At the posterior margins of median plates I–II and paired plates, irregular epicuticular thickenings may be present, especially in larger animals (compare Figs 3 A–B, D). Each of paired plates indistinctly divided by a thin smooth band into a narrow anterior portion with condensed epicuticular matrix, and a larger posterior portion with more complex ornamentation pattern. The proximal part of each posterior portion is thick similarly to the anterior portion, but more distal one is thinner, with reduced and less numerous pores (Figs 3 A–B, D). Marginally, a single dark epicuticular belt is present, and the second belt appears more centrally (Fig. 3A), however, sometimes it is not discernible (Fig. 3B). Caudal (terminal) plate with typical incisions, rarely sclerotised as if being a prolonged extensions of spine E (Fig. 3B). Its epicuticular ornamentation is similar in form to that occurring on the scapular plate (Figs 2, 3A), but may be less developed (Fig. 3B, 3E).

Ventral plates absent, but simple granulation covers the entire venter from the subcephalic to genital zone. Endocuticular pillars minute and not-differentiated in size. Pedal plates and pulvini absent. Spine on the first leg pair minuscule (Figs 2A, 2 C–D, 5A), either in the form of usual triangle or blunt (Fig. 2A). Dentate collar on the fourth leg pair present, with short teeth similar in shape (Figs 2, 3B). Papilla on the fourth leg pair present (Figs 2, 3B). External claws spurless, but internal ones bear acute spurs inserted at ca. 20-25% of the claw branch and directed downwards (Figs 2C, 5). Claws IV longer than claws I–III.

Larvae and eggs. Unknown.

DNA barcodes.

Four genetic markers were represented by single haplotypes. The 18S rRNA sequence (898 bp long, GenBank accession no. MK675903):

GATAACTGTGGTAATTCTAGAGCTAATACATGCAGTAAGCCTTGACCTTTACCGGCAAGGCGCAGTTATTAGATCAAAA ACCAATCGGTTGTGTCTTCGGATGCAGCCGTTAGCTTGGTGACTCTGAGTAACCACAGCGAACCGTATGGCCTCGTGCTC GACGGTCTGTCAGTCAAGCAACTGCCTTATCAGCTTGTTGTTAGGTTATATGCCTAACAAGGCTTCAACGGGTAACGAAC GATCGGGGTCGGATATCGGAGAGGGAGCTTGAGAAACGGCTACCACTTCCAAGGAAGGCAGCAGGCGCGCAAATTACCCA CTCTCGGCATGAGGAGGTAGCGATAAAATGTATCGATGCGGGGCCATTAGTGCCTTCGTAATCGGAATGAGTACACTTTA AATCCTATAACAAGGACCTATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAA TGCTGCTGCGGTTAAAAAGCTCGTAGTCGGATCTGGGTTACCGGCGGGTACCGCATGTTGCTTCACGCAGCATGTTGTGT ACTATACGTGTCGCTTCGGCGGCACTGCCAGTGTAATTGTGCCTCACGTAGGTACGTTACGCTGGTCGCCGGAACCACGA GCCGGGTTGAGCAGCATGCTCTTAATTGAGTGTGTTGTTTACTCGGTGCGTTTACTTTGAAAAAATTGGAGTGCTCAAAG CAAGCGTACAGTCGCTATGCGGCTTGAACAGTGGTGCATGGAATAATGGAATAGGGCCTCGGTTCTATTTTGTTGGTTTT AAGATATCGAGGTAATGATTAAGAGGGACAGACGGGGACGTTTGTATTGCGACGTTAGAGGTGAAATTCTTGGATCGTCG CAAGACACACTAATGCGAA

The 28S rRNA sequence (767 bp long, GenBank accession no. MK675914):

GCTGGACTTAAGCATATTAATAAGCGGAGGAAAAGAAACCAACAGGGATATTCTCAGTAACGGCGAGTGAAGAGAATAcA GCCCAGCGCTGAATCATACTGCTTGCAAGAGTAGTACGACATGTAGCGTGAAACTGGCGGCTGTTGATGTTGTCGATGCGT GTAAGTCTTCTTGATTGAGGCTCAGTCCCAGAGATGGTGCTAGGCCCGTATCGCGCGTGACAAGTACAGCAACGCCCGCTT GTGGAGAGTCAGGTTGTTTGGGAACACAATCTAAAGCCGGTGGTACACTCCATCGAAGGCTAAATATGGCCACGAGTCCGA TAGCGAACAAGTACCGTGAGGGAAAATTGAAAAGCACTTTGAAGAGAGAGCGAAATAGTGCGTGAAACCGCTTAGAGGCAA GCAGATGGATTCTCGAAGGTGTGCATAGGATTTATTTCCTAGTTCTCACGCCACCGCTGTTGTTGACGTGCACCATACGCT GACATTTGGACGCTTGAGATTGGGACTCGTGCCTGCTTGAGCTGCTCGGTGTCGGACGTATTGAGTTGATTCGTGGCATGC GATAACAGAGCAGAGCATTTGTCGTCGCTGTAAAGCGCTGACTGTGGCCGCTTGCTGATGCATTGTTGTTGTGGCAAGGCG CAAGCTTTGACATGCGATATGTATTGCAACTCGGCTATTAGTACCGGCAAGACGACTTCAAGACTCGGTGGCGAGTAGACG AACTTCCATCTAACCCGTCTTGAAACACGGACCAAGGGA

The ITS-2 sequence (442 bp long, GenBank accession no. MK675925):

GGTTTTCTGAACGTTAATTCTTCTAACGCAAATTGCAGCTGTGATTTTAGTCGCAGCTACGCCCGGTTGAGGGTCAGTTG ATCATAAACTCGCTTGTAACTGTTGTAACTACAAGCGCATTGGCTGTTCACATTGACTGCTTCAATGCGGCTGATGTGTTA GCTCAAATTGCCAAGCTGCCAACAAAGCAGTTTCGGATTTCTTGTTATGTATGCTGCTCTAGCAGGTCGTTGTTTGTCAGT ACTATGCACTGCTTCAAGATTATTGTGCGTGCTGACAAAGCTGCGTATGTGTGCGGCAGACAGCATGCGGACCAGTCGTTC GCATGACTCGTCTCTAACGGCATTTGCTTCTCATACACATATAACAAACCAATCATTTTTGTGACCTCAACTCGGACGAGA CTACCCGCTGAATTTAAGCATATCAATAAGCGGAGGAA

The cox1 sequence (614 bp long, GenBank accession no. MK649675):

TACTTTATATTTTTATTTTTTGGTTTATGGGCTGCTTCTGTTGGTTCAAGTTTAAGGTTTTTAATTCGAACTGAATTATC TCAACCAGGAATTTGGTTAGGCGACGAGCATTTATATAATGTCTTAGTTACTTCCCATGCTTTAATTATAATTTTTTTTAT GGTAATACCAATCTTAATTGGTGGTTTTGGTAATTGATTAATTCCTATTATAATTGGTGCCCCGGATATGTCATTTCCTCG AATAAATAATTTAAGTTTTTGGCTTTTACTACCTTCTTTGCTTTTGCTATTGATTTCTTCTAATATTAGATCTGGTGTGGG CTCTGGTTGAACTTTATACCCACCTTTATCTGAATTTATTGGTCATTCTAATTATACTGTTGATATGGCTATTTTTTCTTT CCATGTTGCTGGTGCTTCTTCTATTTTAGGTGCTATTAATTTTATTACTACTATTTTGAATATACGTTTTTTTTCTTTAAA TATAGAACAGTTATCTTTATTTGTTTGATCTGTTTTGATTACTGCTATCTTACTAATTTTATCTTTACCTGTTTTAGCCGG CGGTATTACTATATTATTGTTAGATCGTAATTTTAATAGTTCTTTTTT

Etymology.

From Latin succineus = amber, referring to the locus typicus near Amber Mountain. An adjective in the nominative singular.

Comparative discussion : This is the second known member of the spinulosus group with scapular, paired segmental and caudal (terminal) plates markedly ornamented. Similar system of epicuticular thickenings exists in E. ornamentatus Gąsiorek & Kristensen, 2018 described recently from Tanzania, but an adult specimen of E. succineus sp. nov. is easily distinguishable from the latter taxon based on: the appendage configuration (A-(B)-C-Cd-D-Dd-E in E. succineus sp. nov. vs A-(B)-C-D-Dd-E in E. ornamentatus ), the location of epicuticular ornamentation on the dorsal armour (except for the median plates, all trunk plates ornamented in E. succineus sp. nov. vs only scapular and caudal plates ornamented in E. ornamentatus ), and the pore morphology (very large pores, sometimes with endocuticular dark rings in E. succineus sp. nov. vs minute pores, always without endocuticular dark rings in E. ornamentatus ). The claws II–IV and all claw spurs seem to be relatively longer in E. succineus sp. nov. with respect to E. ornamentatus (compare values from Table 2 with table 4 from Gąsiorek and Kristensen (2018)), but given the low number of collated individuals, these traits are not included in the differential comparison.

Three other species are similar to E. succineus sp. nov. in overall morphology: E. marginatus Binda & Pilato, 1994, E. scabrospinosus Fontoura, 1982 and E. tropicalis Binda & Pilato, 1995. E. succineus sp. nov. differs from:

E. marginatus , reported from Hawaii Archipelago, by the appendage configuration (A-(B)-C-Cd-D-Dd-E in E. succineus sp. nov. vs A-(C)-(D)-Dd-E in E. marginatus ), and the morphology of posterior portions of median plates I–II (narrow and with irregular thickenings in E. succineus sp. nov. vs broad, solid and poreless in E. marginatus , see Pilato et al. 2008);

E. scabrospinosus , known from Western Palaearctic and Afrotropical realm, by the appendage configuration (A-(B)-C-Cd-D-Dd-E in E. succineus sp. nov. vs A-(C)-(D)-Dd-E in E. scabrospinosus ), and the morphology of posterior portions of median plates I–II (with irregular thickenings in E. succineus sp. nov. vs porous in E. scabrospinosus , see Pilato et al. 2008);

E. tropicalis , recorded from the Seychelles, by the appendage morphology (spines in E. succineus sp. nov. vs very short, triangular spicules in E. tropicalis ), and spurs on the internal claws IV (identical to spurs on internal claws I–III in E. succineus sp. nov. vs larger and better developed spurs IV, more divergent from the claw branches than on internal claws I–III in E. tropicalis ).

Comparative genetic analysis: The uncorrected pairwise distances between E. succineus sp. nov. and the remaining Echiniscus spp. were as follows: (1) 18S rRNA - from 0.5% ( E. manuelae da Cunha & do Nascimento Ribeiro, 1962) to 2.5% ( E. testudo ( Doyère, 1840)); (2) 28S rRNA - from 2.7% ( E. manuelae ) to 6.1% ( E. testudo ); (3) ITS-2 - from 17.6% ( E. testudo ) to 22.9% ( E. blumi Richters, 1903); (4) cox1 - from 15.7% ( E. merokensis Richters, 1904) to 18.5% ( E. granulatus ( Doyère, 1840)).