Orzolina kratkyi, Machado, 2025
|
publication ID |
https://doi.org/10.11646/zootaxa.5686.1.7 |
|
publication LSID |
lsid:zoobank.org:pub:D933EC81-9529-471B-AEDD-5A3E401984F1 |
|
DOI |
https://doi.org/10.5281/zenodo.16987123 |
|
persistent identifier |
https://treatment.plazi.org/id/231BEA40-FF99-EC3D-16D2-68AE8ACEFE43 |
|
treatment provided by |
Plazi |
|
scientific name |
Orzolina kratkyi |
| status |
sp. nov. |
Orzolina kratkyi sp. nov.
urn:lsid:zoobank.org:act:
Figs 2A View FIGURE 2 , 3 View FIGURE 3
Type material. HOLOTYPE • 1 ♂ SPAIN, Canary Islands, Tenerife, La Guancha, Charco del Viento , - 1 m. ( 28º24'03"N 16º40'26.5"W) 3-11-2024 leg. A. Machado. Coll. TFMC-EN 4592 GoogleMaps .— PARATYPES. Same collecting data 35 exx (Collection A. Machado, La Laguna; GoogleMaps 3 exx DNA extracted ( BC3397 , BC3398 , BC3399 Coll. IPNA (Institute of Natural Products and Agrobiology ( IPNA-CSIC)); GoogleMaps 34 exx leg. R. Valle ( 30 exx Coll. R. Valle, La Laguna ; GoogleMaps 4 exx Coll. R. García, Santa Cruz de La Palma); GoogleMaps 20 exx leg. A. Aguiar ( 18 exx Coll. A. Aguiar, La Laguna ; GoogleMaps 2 exx Coll. J. Krátky, Czech Republic, Hradec Králové); GoogleMaps 1 ex same locality 30-12-2021 leg. J. Krátky (Coll. J. Krátky, Czech Republic, Hradec Králové). GoogleMaps
Description. Body length 2.7–3.1 mm; integument glabrous, moderately shiny, with superficial isodiametric polygonal microreticulation, tawny in colour, somewhat infuscate on pronotum and elytra, paler on legs; antennae segments 4–11infuscate.
Head about as long as wide; 0.75× narrower than pronotum; mandibles short, pointed inwards; frontal fovea almost obsolete; frontal lateral carinae moderate (shallower bordering eye); eyes oval (L/W= 1.2–1.3), large, but not longer than antennomeres 1 and 2 together, little convex (20%); antennae ca. 3× length of pronotum, with pubescence starting at 4 th segment.
Pronotum small, cup-like, transverse (L/W= 0.65–0.7), narrowed behind, with maximum width before middle (0.65× width of elytra); anterior angles salient; posterior angles markedly obtuse, lacking prebasal sinuosity; lateral channel deep and broad; discal longitudinal line shallow.
Elytra uniformly oval (L/W= 1.43), moderately convex, with apex slightly separate from each other; humeri smoothly curved (shoulders vanished); pre-apical sinuation abrupt (the edge forms a carinate plica at level of 7 th interstria); lateral channel deep, narrowing apicad until reaching apical plica; striae obsolete (punctures sometimes visible by transparency as blackish dots); five long and stiff discal setae on the 3 rd interstria; scutellar, apical, and subapical setae present; umbilical series with 10 setae variably aggregated (i.e., 4+2+4).
Legs slender; protarsomere ♂ 1–2 a little incrassate (particularly the first); mesotarsomeres 2–4 together not longer than onychium; metatarsomere 1 as long as onychium; claws rather long and thin (more than 1/3 length of onychium).
Aedeagus ( Fig. 3 View FIGURE 3 ) with curved median lobe, blunt apex, and a short basal bulb, poorly differentiated; inner sac with a pair of dorsal longitudinal sclerified folded pieces prolonged ring-like to the middle, and a saddle-like strongly sclerified middle-piece. Parameres with a single seta.
Etymology. The species is named after Jiří Krátky (Hradec Kralove), who is deeply interested in the Canarian coleoptera fauna and discovered this new ground-beetle.
Final remarks
Orzolina kratkyi sp. differs from Orzolina thalassophila by its smaller size ( 2.7–3.1 mm compared to 3–3.5 mm), less shiny integument, tawny colour instead of reddish-brown; eyes slightly smaller and less convex; pronotum more transverse (0.65–9.7×), with markedly obtuse hind angles; elytra shorter (L/W <1.4), completely oval (sides not straight and sinuous when reaching base), and less convex. Median lobe of aedeagus plumper and curved (not straight), with shorter basal bulb, and parameres bearing a single seta.
The increased number of discal setae on the elytra and the abrupt sinuation on their preapical edge have evolved separately in several Bembidini lineages associated with intertidal habitat but have no obvious ecological advantages ( Maddison & Maruyama, 2018). However, the very long claws of Orzolina are clearly useful to grasp the animal to the rocks, when the water splashes on them. Indeed, when collecting Orzolina kratky sp. nov. with the aspirator an extra sucking effort was needed to ungrasp them.
Three specimens (BC3397, BC3398, and BC3399) of the new species were sequenced for the mtCOI (680 pb) as part of the project Canary Barcode : towards the genomic inventory of the Canary Islands biodiversity, headed by Brent C. Emerson, at IPNA-CSIC (Genbank PV8282413–5). They show a p-distance of 12.8 % with the sequence provided by Maddison & Maruyama (2018) for O. thalassophila from Órzola, Lanzarote (Genbank MF616721.1).
Barcode sequences
> Orzolina_kratky _Tenerife_PV828413–5
AACCTTATATTTTATTTTTGGAGCTTGATCTGGAATAGTAGGAACTTCTTTAAGAATTTTAATTCGAGCAGAATTA GGAAATCCAGGATCTTTAATTGGAGACGATCAAATTTATAATGTAATTGTCACTGCTCATGCTTTTGTAATAATTT TTTTTATAGTAATACCAATTTTAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATACTCGGAGCTCCAGATAT AGCATTTCCACGAATAAATAATATAAGATCTGACTTTTACCTCCATCTCTAACCCTATTGCTTATGAGATCTATAG TAGAAAAAGGAGCAGGAACAGGATGAACTGTATACCCTCCTTTATCTTCTGTTATTGCTCATAGAGGAGCTTCTGT AGATTTAGCAATTTTTAGTCTTCATCTTGCCGGTGTATCATCAATTCTCGGAGCAGTAAATTTTATTACTACAATT ATTAATATACGATCAATTGGAATAACATTTGATCGAATACCTTTATTTGTATGATCAGTTGGGATCACAGCTTTAC TATTACTTTTATCTTTACCAGTTTAGCAGGAGCTATTACTATATTATTAACAGATCGAAATTTAAATACTTCATTT TTTGACCCAGCAGGGGGAGGAGATCCTATTCTTTACCAACATTTATTT
> Orzolina_thalassophila _Lanzarote_MF616721.1
AACTTTATATTTTATCTTTGGGGCTTGATCTGGTATAATTGGAACTTCCTTAAGAATTTTAATTCGAGCTGAATTA GGAAACCCAGGATCTTTAATTGGAGATGATCAAATTTATAATGTAATTGTAACTGCTCATGCTTTTGTAATAATTT TTTTTATAGTAATACCAATTTTAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATACTTGGGGCTCCAGATAT AGCATTTCCACGAATAAATAATATAAGATTTTGACTTTTACCTCCATCTTTAACTTTATTACTAATAAGATCTATA GTAGAAAAAGGGGCTGGTACCGGATGAACAGTTTACCCCCCCCTATCTTCAACTATTGCTCATAGAGGGGCTTCAG TAGATCTAGCAATTTTTAGTCTTCATCTTGCAGGAGTATCATCAATTTTAGGAGCTGTAAATTTTATTACAACAAT TATTAACATACGATCAATAGGAATAACTTTCGATCGAATACCTTTATTTGTATGATCAGTAGGAATTACAGCTTTA TTGTTATTATTATCACTTCCAGTTTTAGCAGGAGCTATTACTATATTGCTAACAGATCGAAATTTAAATACTTCAT TTTTTGATCCGGCCGGAGGGGGGGATCCAATTCTATACCAACATTTATTT
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
|
Kingdom |
|
|
Phylum |
|
|
Class |
|
|
Order |
|
|
Family |
|
|
Genus |
