Orfelia boreoalpina Salmela
|
publication ID |
https://dx.doi.org/10.3897/BDJ.5.e11760 |
|
persistent identifier |
https://treatment.plazi.org/id/22D872A5-27DC-9E11-6C14-D27D1767D9DF |
|
treatment provided by |
|
|
scientific name |
Orfelia boreoalpina Salmela |
| status |
sp. n. |
Orfelia boreoalpina Salmela ZBK sp. n.
Materials
Type status: Holotype. Occurrence: catalogNumber: DIPT-JS-2014-0233 ; recordedBy: M. Mäkilä; individualCount: 1; sex: M; lifeStage: adult; Taxon: phylum: Arthropoda; class: Insecta; order: Diptera; Location: country: Finland; stateProvince: Lapponia kemensis pars orientalis; municipality: Savukoski; locality: Toermaeoja Conservation Area ; decimalLatitude: 67.823; decimalLongitude: 29.439; Identification: identifiedBy: Jukka E. Salmela; Event: eventDate: 2014-08-07; Record Level: institutionCode: ZMUT GoogleMaps Type status: Paratype. Occurrence: catalogNumber: BIOUG08366-D12 ; recordNumber: bayw.17; recordedBy: G. Sellmayer; individualCount: 1; sex: female; Location: country: Germany; stateProvince: Bavaria; locality: Nationalpark Bayerischer Wald, 11.3 km N of Grafenau ; decimalLatitude: 48.9509; decimalLongitude: 13.422; Event: eventDate: 2012-09-13 /22; Record Level: institutionCode: ZSM GoogleMaps
Description
Male. Head bicolored, vertex with a triangular dark area, laterally yellowish brown (Fig. 1a, b, c). Three ocelli in shallow triangular arrangement, median ocellus smaller than laterals. Vertex covered by short black setae. Clypeus short, yellowish brown. Palpi pale, bearing both light and dark setae. Length ratio of palpal segments 3-5: 3:4=1.2, 4:5=0.67. Penultimate segment 2.25 times as long as wide, last segment 3.86 times as long as wide. Antennae dark brown, flagellomeres bearing dark sensilla that are shorter than width of respective flagellomere. First flagellomere widest apically, its length:width ratio 1.26 (width measured from the apex of the flagellomere). Other flagellomeres quadratic, slightly shorter than wide, except apical one that is elongated and bearing apical papilla; length:width ratios of fourth and last flagellomeres 0.9 and 1.91, respectively (Fig. 1b).
Scutum yellowish with three longitudinal brown stripes; median stripe consisting of two stripes that are largely merged, a narrow anterior gap between the stripes is present (Fig. 1b, c). Dark setae on scutum are present. Pleural sclerites of thorax light brown in colour, all bare except scutellum that has a dense row of setae along posterior margin. Halter light brown with dark setae.
Wings yellowish, with a faint subapical dark band extending from C to M2. Veins dark brown except bm–cu and bRs that are lighter. Veins R1 and bCuA with dorsal setae, R5 setose both ventrally and dorsally. Sc ending in C before bRs. R4 very short, about 0.12 times longer than apical portion of R5. Wing length 4.1 mm.
Coxae yellowish brown - brown, bearing short dark setae, legs yellowish. Ratio of femur to tibia for fore, mid and hind legs: 0.79, 0.68, 0.63. Ratio of tibia to basitarsus for fore, mid and hind legs: 1.67, 1.0, 1.0. Anterior spur of mid-tarsus about 0.5 times longer than posterior spur.
Abdominal tergites and sternites brown, bearing dark setae. Hypopygium brown. 9th tergite widest medially, apex rounded. Gonocoxites dorsally with an outgrowth, bearing a few long apical setae and having a mesial protrusion (Fig. 2a). Cerci prominent, club-like, apically setose, extending to the level of apices of gonostyli (Fig. 2a). Ventral lobe of gonostylus curved, its apical half mostly bare (Fig. 2a, b). Dorsal lobe of gonostylus elongated, pointed in dorsal view, bearing two black subapical long setae (Fig. 2a, b). Aedeagus curved ventrad in lateral view, apex blunt and medially widest in dorsal view (Fig. 2a, b, d). Parameres rod-like, apically dentate (Fig. 2c).
Female.The paratype female is lacking all legs except right fore leg and right hind femur. The specimen is slightly paler than the holotype male. The specimen may be somewhat teneral or it has bleached in the Malaise trap or later in the ethanol. Otherwise the specimen is very similar to the holotype. Antennal flagellomeres, except first and last, are wider than long (length:width ratio of 4th segment is 0.78). Cerci short, apically truncated, gonocoxite 8 short and rounded. Wing length 3.9 mm.
Diagnosis
The new species is characterised by the short and dark antennae, a yellow scutum with contrasting scutellar stripes, brown pleural sclerites of the thorax, brown, unicolorous abdomen and a short R4 vein. The dorsal lobe of gonostylus is strongly curved. The ventral lobe of gonostylus has only two black apical setae, while O. nigricornis (Fabricius) and O. subnigricornis Zaitzev & Menzel have a bunch of setae.
Etymology
The name of the new species refers to its putative boreo-alpine, disjunct range in Europe. The name is a noun in apposition.
Distribution
The new species has been observed from eastern Finnish Lapland, the north boreal ecoregion, and from Germany, Bavaria (see Geiger et al. 2016). It is likely that O. boreoalpina sp.n. has a disjunct European range, having populations in the northern Fennoscandia and the Central European mountains (Fig. 3).
Ecology
The Finnish sampling site was a herb-rich meadow, harbouring vascular plants such as Bistorta vivipara and Trollius europaeus , and is probably flooded during snowmelt in spring. The meadow is surrounded by pine ( Pinus sylvestris ) dominated boreal forest. Bavarian site is a conifer-dominated mountain forest ( Geiger et al. 2016)
Taxon discussion
The new species is rather distant to all other Holarctic species, but it may be closest to O. nigricornis and O. subnigricornis (see below). If using the key provided by Hutson et al. 1980, (species known from Great Britain), the species should either have a largely black or orange thorax, including the pleura, but O. boreoalpina sp.n. has an orange scutum and brown pleura, thus dropping out already in the first couplet. In the key provided by Zaitzev 1994 (Russian species), the new species keys in the first couplet (mesonotum yellow with broad longitudinal stripes). In the couplets 2-5 there are three options, and the new species comes closest to O. nigricornis , that has elongated palpal segments and one pointed outgrowth on the dorsal side of gonocoxites. Orfelia nigricornis , however, has a tuft of setae on the apex of dorsal lobe of the gonostylus while O. boreoalpina has only two dark setae. Other more or less similar species are 1) O. subnigricornis , that is characterized by the yellow scape and pedicel and median flagellomeres that are 1.4 times longer than wide ( Zaitzev and Menzel 1996) (scape and pedicel dark and median flagellomeres about as long as wide in O. boreoalpina sp.n.; in addition dorsal lobe of the gonostylus in O. subnigricornis has a tuft of setae, only two setae are present in the new species), 2) O. sachalinensis (Matsumura) has a yellow abdomen and indistinct scutal stripes (see Okada 1938, as Zelmira sachalinensis ) ( O. boreoalpina sp.n. has a brown abdomen and strong scutal stripes) and 3) O. minima (Giglio-Tos) that has a yellowish scape, pedicel and a yellowish abdomen ( Giglio-Tos 1890) (all dark in O. boreoalpina sp.n.).
DNA barcoding
Holotype male: BOLD Sample ID: DIPT-JS-2014-0233. BOLD Process ID: SCFI064-15. GenBank accession number: KY062990.
AACATTATATTTTATTTTAGGGACATGGTCAGGAATACTAGGAACATCAATAAGAATTTTAATTCGAGCAGAATTAGGATATCCGGGAGCATTAATTGGAAACGACCAAATTTATAATGTTGTAGTCACAGCTCATGCTTTTGTAATAATTTTTTTTATAGTTATACCTACTATAATTGGAGGTTTCGGAAATTGATTAGTACCTTTAATATTAGGGGCCCCAGATATGGCTTTTCCTCGAATAAATAACATAAGATTTTGACTTCTCCCTCCTTCACTTTCTTTACTATTAATAAGAAGAATAGTAGAAAGTGGTTCTGGAACAGGATGAACTGTATATCCTCCCCTATCTTCTACTTTATCTCATTCTGGTAGATCAGTTGACTTAACTATTTTTTCTCTTCATTTAGCAGGAATTTCTTCAATTCTTGGGGCAGTCAATTTTATTACTACAATTATCAACATACGATCACCTGGGATAAACATAGACATAATACCTTTATTTGTATGATCAGTTTTTATTACAGCCATTCTTCTTCTTTTATCATTACCTGTACTAGCGGGAGCAATTACAATACTTTTAACAGATCGTAATTTAAATACATCATTTTTTGATCCAGCAGGTGGGGGTGACCCAATTCTATATCAACATTTATTT
The DNA barcode of the paratype specimen is almost identical to the holotype, their similarity is 99.54 %. The type specimens belong to the same BIN (BOLD:ACJ7389) shared by no other members. The nearest specimens are rather distant: 97 closest sequences have similarity values between 88.25 and 86.35, being assigned to O. nemoralis (Meigen) (54 specimens), O. nigricornis (2), Keroplatidae (40) and Mycetophilidae (1). DNA barcode and associated data of the paratype is available from the BOLD Public data portal.
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
|
Kingdom |
|
|
Phylum |
|
|
Class |
|
|
Order |
|
|
Family |
|
|
Genus |
