Salantoia metallica, Zhang & Cong & Shen & Grishin, 2022

Zhang, Jing, Cong, Qian, Shen, Jinhui & Grishin, Nick V., 2022, Taxonomic changes suggested by the genomic analysis of Hesperiidae (Lepidoptera), Insecta Mundi 2022 (921), pp. 1-135 : 13-15

Salantoia metallica Grishin, new species

http://zoobank.org/ 8CC4BEC6-D009-4F8A-B2CC-9AC227EB20A7

Definition. Genomic analysis reveals that one female specimen (NVG-2683) in the USNM collection belongs to Salantoia , together with S. gildo and the type species S. eriopis ( Fig. 1 ), but is not identifiable to species either genetically (it did not match any of the species we have sequenced) or phenotypically, and therefore is new. Female of this species ( Fig. 2d,e ) is distinguished from other Salantoia by extensive greenish-yellow metallic sheen on its body and all wings above and below. The sheen is most extensive on hindwing and the basal half of forewing, basad of a discal hyaline band from mid-costa to tornus, composed of four aligned spots narrowly interrupted by three darker veins. In addition to the band, forewing with three subapical hyaline dots, the one in cell R 5 -M 1 offset distad from the two others, and one dot in cell M 3 -CuA 1 by vein CuA 1. This banded pattern (but not the subapical dots) and metallic sheen reminds of Porphyrogenes Watson, 1893 (type species Telegonus omphale Butler, 1871 ), but the new Salantoia species differs in the structure of palpi with the 3rd segment very short, mostly hidden among the scales (not protruding much beyond) of the 2nd quadrantic (not cylindrical) segment; the structure of antennae: stronger thickened at the club and with very long nudum of 34 segments ( Fig. 2f ) vs. up to 25 in Porphyrogenes according to Evans (1952: 136), and by weakly defined but yet clearly visible pale discal spots on ventral hindwing complemented with similar spots in discal cell and at the basal third of cell Sc+R 1 -RS. Sterigma in female genitalia does not offer unusual features: with broad and short, wide-M-shaped well developed lamella antevaginalis and postvaginalis ( Fig. 2g ). Male is unknown and is not among specimens we have sequenced. The COI barcode sequence of the holotype is:

AACTTTATATTTTATTTTTGGAATTTGAGCCGGAATAGTAGGAACTTCATTAAGATTACTAATTCGAACAGAATTAG GTACCCCTGGATCTTTAATTGGAGATGATCAAATTTACAATACTATTGTAACAGCTCACGCTTTTATTATAATTTTTTT TATAGTAATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTCCCTTTAATATTAGGAGCCCCTGATATAGCATTTC CACGAATAAATAATATAAGATTTTGATTATTACCTCCATCTTTAACACTATTAATTTCAAGAAGAATTGTAGAAAATG GAGCAGGTACAGGATGAACAGTTTATCCTCCTTTATCAGCTAATATTGCACATCAAGGATCTTCAGTTGATTTAG CAAT T T TCTCTCT TCAT T TAGCTGGAAT T TCATCTAT T T TAGGAGCTAT TAAT T T TAT TACAACAAT TATCAA CATACGAATTAAAAATTTATCTTTTGATCAAATACCATTATTTGTTTGAGCTGTTGGAATTACAGCTTTATTATTAT TACTTTCATTACCTGTATTAGCAGGTGCTATTACAATACTTTTAACAGACCGAAATTTAAATACTTCATTTTTTGATCCT GCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Type locality. Guyana: Acarai Mts., Sipu River, 900′–2500′, GPS 1.387, −58.947.

Type material. Holotype, female deposited in the National Museum of Natural History , Smithsonian Institution , Washington, DC, USA ( USNM), with the following rectangular white labels: || GUYANA: Acarai Mts. | Sipu R. 900′–2500′ | 29.X.-12.XI.2000 | 1°23.2′N 58°56.8′W | Leg. S.Fratello et al || DNA sample ID: | 11-BOA-13383B08 | c/o Nick V. Grishin || DNA sample ID: | NVG-2683 | c/o Nick V. Grishin || NVG140628-53 || [barcode image] | USNM ENT 00179743 ||. The holotype was sampled for DNA twice: a leg sample (11-BOA-13383B08) and abdomen extraction ( NVG-2683 ) prior to genitalia preparation stored in a vial (NVG140628-53) by the specimen. The holotype identification label will be mailed to the curators of the collection. No other specimens are known.

Etymology. The species is named for the metallic sheen of the wings not present in other Salantoia . The name is a feminine adjective.

Figures

Figure 1. Genomic tree of Eudaminae. The tree is constructed from protein-coding regions. The tree is rooted with Pterourus glaucus (Linnaeus, 1758) (NVG-1670), not shown. Statistical support values are shown on nodes. For each specimen, its name adopted in this work is given first, and a previously used name is listed in square brackets (if different), supplemented with the DNA sample number, type status (see Table 2 caption for abbreviations) and general locality. See Table S1 in the Supplemental file for additional data about these specimens. Synonyms are given in parentheses preceded by “=”, and in addition by “‡” for unavailable names. The type status refers to this synonym, if the synonym name is provided. Clades corresponding to new genera, subgenera and species are colored in red, orange and green, respectively, and the names of new taxa are highlighted accordingly. Names of selected tribes, subtribes, genera, and subgenera are labeled at their clades. Clades corresponding to some genera are highlighted in yellow to compare their genetic diversifications (length of the highlight in horizontal dimension) with each other. Groups of similar genetic diversification would ideally correspond to genera. The

Figure 2. Holotypes of the Eudaminae species described in this work: a) Ornilius rotundus Grishin, gen. n., sp. n. dorsal; b) ibid. ventral; c) Dyscophellus australis Grishin, sp. n. dorsal; d) Salantoia metallica Grishin, sp. n. dorsal; e) ibid. ventral; f) ibid. left antennal club in ventro-anterior view, nudum facing up, 1 mm scale above; g) ibid. sterigma and ovipositor in ventral view, 1 mm scale below; h) Telegonus subflavus Grishin, sp. n. dorsal; i) ibid. ventral; j) Dyscophellus basialbus Grishin, sp. n. dorsal; k) ibid. ventral. Specimen images are to scale (shown under image a) and data are in the text. Photograph c (by N.V.G.) is © of the Trustees of the Natural History Museum London and is made available under Creative Commons License 4.0 (https://creativecommons.org/ licenses/by/4.0/).