Bowie borneo S. Li & Yao, 2022
|
publication ID |
https://dx.doi.org/10.3897/BDJ.10.e96003 |
|
publication LSID |
lsid:zoobank.org:pub:2A9D4A67-DC00-40DC-9745-BF531D767F55 |
|
persistent identifier |
https://treatment.plazi.org/id/0ABF3BD1-8C4A-56D1-8838-1F91D4F3A751 |
|
treatment provided by |
|
|
scientific name |
Bowie borneo S. Li & Yao |
| status |
sp. n. |
Bowie borneo S. Li & Yao sp. n.
Materials
Type status: Holotype. Occurrence: recordedBy: Z. Chen; individualCount: 1; sex: male; lifeStage: adult; Taxon: order: Araneae; family: Ctenidae ; genus: Bowie ; Location : country: Malaysia; stateProvince: Borneo ; verbatimLocality: State of Sabah, Mount Trus Madi , Jungle Girl Camp ; verbatimElevation: 1234 m a.s.l.; verbatimLatitude: 5°33.000'N; verbatimLongitude: 116°30.960'E; Event: samplingProtocol: Collected by hand in leaf litter; year: 2016; month: 4; day: 27; Record Level: institutionCode: IZCAS-Ar 43730 GoogleMaps GoogleMaps
Description
Male (IZCAS-Ar 43730): PL 3.8, PW 2.9, AW 1.2, OL 3.2, OW 2.2. Eye diameters and interdistances: AME 0.17, ALE 0.15, PME 0.22, PLE 0.21, AME-AME 0.14, AME-ALE 0.11, PME-PME 0.24, PME-PLE 0.27, AME-PME 0.11, ALE-PLE 0.13, clypeus AME 0.09, clypeus ALE 0.37. Palp and leg measurements: palp 5.1 (2.5, 0.5, 0.8, -, 1.3), I 12.1 (2.8, 1.5, 3.2, 3.3, 1.3), II 10.9 (3.2, 1.3, 2.6, 2.7, 1.1), III 9.6 (2.7, 1.1, 2.1, 2.6, 1.1), IV 15.1 (4.0, 1.4, 3.3, 4.7, 1.7). Leg formula 4123. Spination of palp and legs: palp 151, 100, 1110; femora I p012, d111, r012, II-III p112, d111, r112, IV p112, d111, r002; patellae I-II 100, III-IV 101; tibiae I p010, r010, v212222, II p100, d001, r110, v22222, III-IV p11, d111, r11, v222; metatarsi I p111, r011, v222, II p111, d002, r111, v222, III p111, d012, r111, v222, IV p111, d012, r111, v2212. Chelicerae with 3 promarginal, 4 retromarginal teeth and with elongated patch of 8 tiny denticles along entire cheliceral furrow. Retromargin of chelicerae close to fang base with 4 bristles. Sparse scopula on all tarsi. Leg claws I-II with 5 and III-IV with 4 secondary teeth. Position of tarsal organ: I 1.07, II 0.89, III 0.72, IV 1.06.
Palp (Fig. 22 View Figure 22 a-c). RTA protruding at an almost right angle from tibia in ventral view, with slightly hooked tip. Cymbium tip slightly conical and with weakly developed dorso-proximal outgrowth. Embolus (Fig. 28 d) arising at 7 o’clock position. Conductor arising at 11 o’clock position. Tegular apophysis arising from tegulum sub-proximally, with narrow base and wide tip.
Colour (Fig. 23 View Figure 23 a and b). Yellowish-brown with darker patterns. Dorsal prosoma with characteristic lighter median band, widened behind eyes, eye field with sparse white hairs, with distinctly marked fovea and distinct radial markings. Sternum, labium, gnathocoxae and ventral coxae yellowish-brown without patterns. Chelicerae reddish-brown with longitudinal patterns. Palps and legs yellowish-brown, legs II-IV with distinct patterns. Dorsal opisthosoma yellowish with black patches, anterior margin and central region light. Lateral opisthosoma spotted. Ventral opisthosoma yellowish-brown with posteriorly converging lines of spots. Anterior lateral spinnerets laterally dark, posterior lateral and median spinnerets and anal tubercle light.
Female
Unknown.
Diagnosis
Small Ctenidae (total length male 7.0). The new species is assigned to the chinagirl -species group with the characteristics of compact embolus, thick-walled, with rounded edges and with an entire margin, the tegular apophysis is longitudinally elongated, not covering the embolus. It resembles B. abdulmajid Jäger, 2022 (see Jäger 2022: figs 638-643 and 696-699) by having similar dorso-proximal cymbial outgrowth, embolus and RTA (Fig. 22 View Figure 22 a-c and Fig. 28 d), but can be distinguished by the base of tegular apophysis having no bulge (Fig. 22 View Figure 22 b; the base of tegular apophysis bulging beyond tegulum margin in B. abdulmajid ), by the tibia having no distinct broad longitudinal ridge ventrally (Fig. 22 View Figure 22 b; tibia with distinct broad longitudinal ridge ventrally in B. abdulmajid ) and by the conductor nearly quadrilateral (Fig. 22 View Figure 22 b; conductor nearly oval in B. abdulmajid ).
Etymology
The specific name refers to the type locality and is a noun in apposition.
Distribution
Malaysia (Borneo, type locality; Fig. 1 View Figure 1 ).
DNA Barcode
Male (IZCAS-Ar 43730):
GGTTTGGTGCTTGGGCTTCTATAGCAGGTACGTCTATAAGAGTTTTGATTCGAATGGAATTAGGACATTCTGGAAGATTATTAGGGGATGATCATTTATATAATGTTGTTGTTACTGCTCATGCTTTTGTTATAATTTTTTTTATAGTGATACCTATTTTAATTGGTGGTTTTGGAAATTGGTTGGTTCCTTTAATATTAGGAGCTCCTGATATATCTTTTCCTCGTATAAATAATTTGTCGTTTTGATTACTTCCTCCTTCTTTATTTTTATTGTTTATATCTTCTATGACTGAGATAGGGGTGGGAGCTGGTTGGACGGTTTATCCACCTTTGGCTTCTGGAATTGGTCATGCAGGAAGATCGATAGATTTTGCTATCTTTTCTCTCCATTTAGCAGGTGCTTCTTCTATTATAGGAGCTATTAATTTTATTTCTACGATTATTAATATACGATTATTAGGAATGAGAATGGAAAAGGTTCCTTTGTTTGTATGGTCTGTTTTTATTACTGCAGTTTTATTATTATTATCTTTACCTGTTTTAGCGGGTGCTATTACTATATTATTAACGGATCGTAATTTTAATACTTCTTTTTTCGATCCTGCTGGAGGAGGGGATCCAATTTTATTTCAACATTTATTTTGATTTTTTG (GenBank accession number OP572103).
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
