Microtia elvira, Zhang & Cong & Shen & Song & Grishin, 2023

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2023, Butterfly classification and species discovery using genomics, The Taxonomic Report of the International Lepidoptera Survey 11 (3), pp. 1-94 : 23-26

Microtia elvira Grishin, new species

http://zoobank.org/ 17FC3D08-DF04-487B-A1F1-F536C01E624F ( Figs. 10 part, 11, 12a, b)

Definition and diagnosis. Genomic sequencing of Microtia H. Bates, 1864 (type species Microtia elva H. Bates, 1864 ) specimens reveals a deep split within its type species ( Fig. 10). The western clade ( Fig. 10 red) is profoundly differentiated from the eastern clade ( Fig. 10 blue) with the Z chromosome Fst / Gmin of 0.60/0.006 and COI barcode difference of 4.7% (31 bp), which is more than expected from phenotypic similarity. This scenario parallels that of Microtia perse (W. H. Edwards, 1882) (type locality in USA: AZ, Graham Co.) vs. Microtia elada (Hewitson, 1868) (type locality in Mexico) ( Fig. 10 green vs. violet). Therefore, the two clades represent distinct species. Specimens from around the type locality ( Guatemala) belong to the eastern clade. Curiously, Microtia elva horni Rebel, 1906 (type locality in Mexico: Oaxaca) and its junior subjective synonym Microtia elva form draudti Röber, [1914] (type locality in Mexico, “Coatepec” on the label of a syntype) ( Fig. 10 teal colored), which are also in the eastern clade but are visually rather distinct in their much broader orange-yellow markings and nearly half of dorsal hindwing orange-yellow, are not particularly different genetically from the nominotypical M. elva . Thus, the western clade does not have available names associated with it and represents a new species. This new species is most similar to M. elva , with which it was previously combined. Distinguished from M. elva by largely yellow or orange-yellow tibiae and frequently other leg parts (legs in M. elva are back). Additionally, characterized by narrower orange-yellow bands and thinner, bar-like (particularly in males) orange-yellow mark by the middle of the inner forewing margin ( Figs. 11, 12a). In M. elva , this bar is more rounded, larger, and can be nearly triangular and much broader at the base, widening both distad and basad (Fig. 12c). The outer edge of the hindwing discal band (on both dorsal and ventral sides) is more angled in the middle ( Figs. 11, 12b), instead of straighter and more rounded edge in M. elva ( Fig. 11d). Due to variation in colors and patterns, most confident identification is provided by DNA. The following combination of characters is diagnostic in the nuclear genome: hm2014195-RA.2:C190T, hm2014195- RA.2:T201A, hm2016592-RA.17:G261A, hm2017493-RA.1:G240A, hm2008057-RA.6:T171C and COI barcode: G38A, C238C, 421C, A583T, T637C.

Barcode sequence of the holotype: Sample NVG-22096 H10, GenBank OR578711 , 658 base pairs: TACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAATTGGAACATCTTTAAGACTTTTAATTCGAACTGAATTAGGAAACCCAGGATCATTAATTGGAGATGATCAAATTTATAATACT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAATTCCATTAATATTAGGAGCTCCTGATATAGCTTTCCCCCGAA TAAATAATATAAGATTTTGACTACTACCCCCATCACTTATATTATTAATTTCTAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTGTACCCCCCACTTTCTTCTAATATTGC TCATAGAGGATCATCTGTTGATTTAGCAATTTTTTCACTACATCTAGCAGGAATTTCCTCAATTCTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAATAATATATCA TTTGATCAAATACCTTTATTTGTTTGAGCAGTTGGTATTACAGCTCTTTTATTATTATTATCTTTACCAGTATTAGCAGGAGCTATTACTATACTCCTTACTGATCGAAATATTAATACAT CATTTTTTGACCCAGCTGGAGGAGGGGATCCCATTTTATATCAACATCTATTT

Fig. 12. Microtia elvira sp. n. ( a, b) and Microtia elva ( c, d) iNaturalist observations: USA: AZ, Santa Cruz Co.: a) 144668453 Montosa Canyon, GPS 31.6727, −110.9406, 19-Aug-2016 © jmbearce; b) 141491956 Atascosa Mts. , California Gulch , GPS 31.4220, −111.2404, 3- Oct-2014 © Ken Kertell ; and Mexico: Nuevo Leon, Monterrey : c) 4292755 Parque la Estanzuela , GPS 25.5507, −100.2707, 7-Oct-2016 © Roberto González ; d) 171257635 Guadalupe , Contry Sol , GPS 25.6505, −100.2648, 5-Jul-2023 © Rodolfo Salinas Villarreal. Arrows in b) and d) point at the legs to draw attention to their color difference. Images are color-corrected and rotated. CC BY-NC 4.0 https://creativecommons.org/licenses/by-nc/4.0 /

Type material. Holotype: ♂ deposited in the Los Angeles County Museum of Natural History, Los Angeles, CA, USA [ LACM], illustrated in Fig. 11, bears three printed (number “12” handwritten) labels: two white [ October 12, 1954 | Madera Canyon, Santa Rita Mt’s. | Southern Arizona. | W. Rees & H. Reid], [DNA sample ID: | NVG- 22096H10 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Microtia elvira | Grishin ]. Paratypes: 5♂♂ 2♀♀: 1♂ USA, Arizona, Santa Cruz Co., Sycamore canyon, GPS 31.4213, −111.1942, 25-Sep-2015, Brian Banker leg. ( NVG- 21091A03); others at LACM, Mexico: Sonora: 2♂♂ Rio Cuchujaqui, 8 rd. mi E of Alamos, el. 1000', 30-Aug-1976, J. P. & K. E. Donahue leg. ( NVG- 22096G07 & G08); 1♀ Alamos, 25-Jul-7-Aug-1953, Fred S. Truxal leg. ( NVG- 22096H08); 1♂ Sinaloa, 27.8 km S Culiacán, 30-Aug-1976, C. D. George & R. K. Snelling leg. ( NVG- 22097A04); 1♂ 1♀ Nayarit, 5–10 mi N of Tepic, 2500'-3000', 13-Dec-1946 ( NVG- 22097A03 & A01).

Type locality. USA: Arizona, Pima /Santa Cruz Cos., Santa Rita Mountains, Madera Canyon .

Etymology. The meaning of the name Elvira is typically associated with traits such as truthful, trustworthy, or pure, and also noble or elf-like. Formed from the name of its sister species, elva , it signifies our high confidence that this is a “trustworthy” species, i.e., strongly differentiated from M. elva but is elva - or elf-like. The name of this western counterpart of M. elva is longer to mean that it takes a long day from sunrise in the east to sunset in the west. The name is a feminine noun in apposition.

English name. Elfoid.

Distribution. Southeastern Arizona and western Mexico (confirmed from Sonora, Sinaloa, and Nayarit).

Comment. Both M. elvira sp. n. and M. elva occur in the USA. Microtia elva strays into the lower Rio Grande Valley of Texas, e.g., a male from Brownsville in Cameron County collected by William W. & Nadine McGuire on 20-Jul-1971 [TAMU] that we sequenced as NVG-10626 ( Fig. 10).

http://zoobank.org/ 3EE47FD0-31EF-4CE0-BE21-5DC240F1FFEC

( Figs. 13 part, 14–16)

Definition and diagnosis. Inspection of nuclear genomic trees reveals that a single specimen from Mexico, Sonora, initially identified as “ Cyllopsis pertepida ”, is confidently placed as sister to the clade of three species: Cyllopsis gemma (Hübner, 1808) , Cyllopsis pertepida (Dyar, 1912) , and Cyllopsis pyracmon (A. Butler, 1867)

( Fig. 13a, b, red and blue), and therefore represents a species distinct from them. In the mitochondrial genome tree, which has lower statistical support, this species is also in the same clade with the three others but is sister to C. gemma ( Fig. 13c). Because all other described species of Cyllopsis R. Felder, 1869 ( type species

Cyllopsis hedemanni R. Felder, 1869 ) belong to other clades ( Fig.

13) and are phenotypically different ( Miller 1974), this species is new. It differs from its relatives by a combination of larger size

(forewing length about 20 mm, while typically less than 18 mm in

C. gemma ), a large androconial patch (cut by veins) in the discal Fig. 15. Cyllopsis brocki sp. n. (possible), iNaturalist observation 142409312 Mexico: Sonora, area of the dorsal forewing (absent in C. gemma ), postdiscal brown Yécora, GPS 28.3783, −108.8370, 3-Sep-2018, © line strongly toothed towards the margin at vein M 1 and not jmbearce. Brightened and color-corrected. CC BY-NC reaching the costal margin (as in C. gemma and some C. pertepida , 4.0 https://creativecommons.org/licenses/by-nc/4.0/ but not in C. pyracmon ), more extensive and coarse mottling on the ventral side of wings, especially in the basal part of the hindwing (as in some C. pyracmon but not in other species), and reduced rusty overscaling dorsally: wings appear more brown than reddish ( Figs. 14, 15). In male genitalia (Fig. 16), diagnosed by broader valva with more convex costa-ampulla, valva more distinctively narrowing into harpe in lateral view, harpe with broader and more angular distal end in dorsal view shaped like a triangular plate rather than ending in a point. In DNA, a combination of the following characters is

Type locality. Mexico: Sonora, Yécora, E of Santa Rosa , Trinidad-Yecora Rd., 3–5mi E of Trinidad mine .

Etymology. The name honors Jim P. Brock, the collector of the holotype and one of the finest and most knowledgeable Lepidopterists with a sixth sense for butterflies and caterpillars, finding them effortlessly (or so it seems) where others fail. Jim’s significant contributions to butterfly knowledge delivered through his many books, presentations, and nature tours can only be matched by his contagious excitement, passion for sharing his expertise, and unsurpassed kindness. We deeply appreciate Jim's extensive support of our projects throughout the years. The name is a singular noun in the genitive case.

Distribution. Known only from the holotype collected in Mexico: Sonora.

Comment. The type locality of this new species is near the type locality of Amblyscirtes brocki H. Freeman, 1992 ( Hesperiidae ), with its two paratypes collected on the same date and at approximately the same place as the holotype of Cyllopsis brocki sp. n.