Baritius flexuosus, Grados, 2018

Grados, Juan, 2018, Four new species and one new subspecies of Arctiinae (Lepidoptera: Erebidae) from the Tambopata river, Madre de Dios, Peru, Zootaxa 4434 (1), pp. 29-48 : 43-45

Baritius flexuosus sp. nov.

( Figs. 39–44 )

Holotype male ( Figs. 39–40 ): PERU, Madre de Dios, Albergue Refugio Amazonas, 12°52'30''S, 69°24'35''W, 231m, 11.v.2016 (D. Couceiro) . Paratypes (11 males): PERU, Madre de Dios , 1 male, Albergue Posada Amazonas, 12°47'S, 69°14'W, 250m, 18.v.2002 (J. Grados ); 1 male, idem except, 11.ix.2002 (A. Lescano); 1 male , CICRA, Río Los Amigos , 12°34'07.35''S, 70°05'56.8''W, 280m, 08.xii.2005 (J. Grados); 1 male , Río Alto Madre de Dios, nr. Atalaya, 12°53'S, 71°22''W, 587m, 23.vi.2006 (P. Centeno ); 1 male, Albergue Refugio Amazonas, 12°52'30''S, 69°24'35''W, 231m, 13.iii.2016 (J. Grados ); 1 male, idem except, 21.iv.2016 (Adam Julian, Aaron Edward & D. Couceiro); 1 male, idem except, 11.v.2016; 1 male, idem except, 19.v.2016; 1 male, idem except, 27.v.2016; 1 male, idem except, 28.v.2016; 1 male, idem except, 01.vi.2016.

Diagnosis (male): Head and thorax creamy, the latter with brown spots. Antennae bipectinated, creamy and with brown spots. Forewings creamy with a series of brown spots in lunular and rounded shapes. Hindwings with a cream anterior half and the posterior one of a pink hue. Dorsal surface of the abdomen pink and the ventral surface, whitish.

Description male: ( Figs. 39–40 ). Forewing span (13–15 mm) (n=12). Head: Frontoclypeus creamy, with brown scales between the antennae. Vertex creamy with a brown spot in the central area. Palpi creamy. A brown spot on the external lateral side of the first segment. The second segment with a brown spot on the external lateral side, covering two–thirds of the length. Third segment small with brown scales at base. Proboscis elongated and brown. Antennae bipectinate and creamy, with brown spots at the base, at the middle and towards the distal end. Thorax: Patagia creamy with presence of brown scales, in greater density towards the anterior part. Tegulae creamy, with brown scales towards the anterior part and in the mesal margin, near the patagia and a small brown spot in the central part. Lines of brown scales on the sides of the mesoscutum that converge in the central part and project in a line up to the mesoscutellum. Metascutellum whitish. First pair of legs creamy, with small brown spots scattered over the tibia. A brown spot in the central part of the first tarsal segment. Brown the distal half of the third, fourth and fifth tarsal segment. Second pair of legs creamy, with a brown spot on the proximal end of the tibia and another one elongated at the distal end. A brown spot in the central part of the first tarsal segment and brown the fourth and fifth segments. Third pair of legs creamy, with a brown spot in the central part of the tibia. A brown spot on the proximal part of the first and third tarsal segments. The last two, brown. Cream tibial spurs. Forewing: Color pattern in dorsal surface is dominated by an irregular lattice of creamy and brown colored areas. Background creamy yellowish with a brown line near the base of the wing, from the costal margin up to anal cell. Two brown spots that arise from the costal margin and separated by a cream area, going towards the posterior part and converging in the discal cell, reaching the posterior margin. A brown spot from the costal margin, crosses the R, continues having as mesal limit the discal cell, between M1 and M3, projecting itself up to the proximal part of cell M3-Cu1. It is projected having only one point of contact towards the ectal margin, in cell Cu1-Cu2, reaching the termen and near the tornus, like a cream spot with brown borders in the 1A-2A. Towards the mesal margin of the spots of cells Cu1-Cu2 and 1A-2A, a cream spot corresponding to each one. Another cream spot with brown border, close to the termen, from the distal margin of M3-Cu1 and ascending in the respective cells, rounded spots until the costal margin. A brown spot towards the subdistal area of the M1-M2. Ventral surface c reamy yellowish, the traits indicated for the dorsal side are noticeable, being more noticeable in the costal margin and the termen. Hindwing: Dorsal surface semihyaline from the costal margin to the middle of the wing. The other half of a soft pink hue. Ventral surface whitish, the traits indicated noticeable for the dorsal side. Abdomen: Dorsal side pink and ventral whitish. Distal end with white hairs. Male genitalia ( Figs. 41–44 ) (Genitalia # JGA 738): Tegumen with thin and sinusoid sides, both non–symmetrical, becoming somewhat wider towards the posterior part. Uncus thin and elongated, with the distal end wider, expanding laterally with short and thin projections and hair on all its dorsal side. Transilla bearing two elongated structures ornamented with spicules. Non–symmetrical valvae, the left being longer. The valvae are widened in the middle and have setae in the dorsal and ventral margin. Towards the distal part, the valvae get thinner to project in a curved form towards the mesal margin. The latter carries spines, mainly in the inner part. The valvae in ventral view, wide near the base, from where they carry series of setae, to then become narrower in a defined concave arc, to expand towards the middle and, then to become thin again in the long process and that carries the thorns. Juxta divided and well defined, broad and with a projection in the central posterior part, with a very sclerosed line throughout its length. Aedeagus thick and with a sclerosed area in the distal part. Vesica elongated. Female: Unknown

Etymology: flexuosus is a masculine adjective in nominative singular, which means tortuous, sinuous, in allusion to how difficult it is to distinguish the new species from the already known species.

Distribution: Only in the department of Madre de Dios, southeastern Peru.

Barcoding: The access number to Genbank is MG837875 . The mitochondrial DNA sequence (COI) of one of the paratypes is as follows (Voucher MUSM– Arctiinae VB # 58):

AACTTTATATTTTATTTTTGGTATTTGGGCAGGAATATTAGGAACTTCATTAAGTTTATTAATTCGAGCTG AATTAGGAAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTT TATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTTCCTTTAATATTA GGAGCTCCTGATATAGCTTTCCCTCGAATAAATAATATAAGTTTTTGACTTCTACCCCCATCATTAACTT TATTAATTTCGAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTATCCCCCCCTTTCA TCTAATATTGCTCATGGAGGATCATCAGTAGATCTAGCTATTTTCTCCCTTCATTTAGCCGGAATTTCTTC AATTTTAGGAGCAATTAATTTTATTACAACAATTATTAATATACGATTAAATAATTTATCTTTTGATCAAAT ACCTTTATTTGTTTGAGCTGTAGGAATTACAGCATTTTTATTATTACTTTCTCTTCCAGTTTTAGCAGGA GCAATTACAATATTATTAACAGATCGAAATTTAAATACATCATTTTTTGACCCCGCTGGAGGAGGAGAT CCAATTCTTTAT

Remarks: The species Baritius eleutheroides Rothschild was described from 43 males and 5 females, from different localities: Fonte Boa, Upper Amazon ( Brazil); Manaos to Yutobi River ( Brazil); La Oroya, Inambari River ( Peru); La Union, Huacamayo River, Carabaya ( Peru); Aroewarwa Creek, Maroewym Valley ( Suriname) ( Rothschild, 1909).

Vincent & Laguerre (2014) designated the lectotype of the species, choosing the male syntype from Fonte Boa ( Brasil). According to the analysis of the types and individuals housed at MUSM, they belong to a complex of species, very similar in external morphology and color pattern, differentiated by subtle external characters and by genitalia morphology.

It is possible to differentiate B. eleutheroides from B. flexuosus based on the following features: in B. flexuosus the postdiscal brown band is on the costal margin and projects close to the tornus, while in B. eleutheroides the band is continuous all the way to the tornus. The band in the new species is discontinuous due to a contraction it presents at cell M3-Cu1, so that towards external margin there are five rounded creamy spots between R3+R4 and Cu1. Regarding the male genitalia, B. eleutheroides has shorter and wider valvae at base, with round distal end, while B. flexuosus the valvae are widened in the middle and have setae in the dorsal and ventral margin. Towards the distal part, the valvae get thinner to project in a curved form towards the mesal margin. The latter carries spines, mainly in the inner part.nThe elongated structures of the transtilla are triangular in B. eleutheroides , while in B. flexuosus are two elongated structures ornamented with spicules. The genetic distance between both species is 2.9%.

Figures

FIGURES 39–40. Baritius flexuosus Grados, new especies. 39. Holotype male, dorsal. 40. Holotype male, ventral. Scales=5 mm.

FIGURES 41–44. Genitalia of Baritius flexuosus Grados, new species. (Genitalia # JGA–739). 41. Dorsal view. 42. Ventral view. 43. Lateral view. 44. Aedeagus. Scales= 1 mm.