Merodon bicolor

Milankov, Vesna, Ludoški, Jasmina, Ståhls, Gunilla, Stamenković, Jelena & Vujić, Ante, 2009, High molecular and phenotypic diversity in the Merodon avidus complex (Diptera, Syrphidae): cryptic speciation in a diverse insect taxon, Zoological Journal of the Linnean Society 155 (4), pp. 819-833 : 827-828

MERODON BICOLOR GIL COLLADO, 1930 COMB. NOV.

Merodon spinipes bicolor Gil Collado, 1930: 254

Based on morphology ( Marcos-García et al., 2007), M. avidus from Spain ( Marcos-García, 1985, 1990)

22222222222222222222222222222222222222222222222222222 22233333344444444444555555566666666677777778888888999 55914468901133555789001345800022455912456790023779569 36590612162537147280257249347828928554579862865173248 Population Haplotype * * * * * VM567 AMOR, June I TATATCCTTTTAATCTTTGTACATTCCTATTTTCTCCCCCAATTTTCTCTTGC VM581 AMOR, August II ................................C....T...G.....C..... VM596* AMOR, August III.G..............................C....T.-------------- VM615 ADUB, September IV .....................................T..G......C...A. VM590 BDUR IV .....................................T..G......C...A. VM 823 M. avidus, Lesvos IV .....................................T..G......C...A. VM560 BMAV V .....................................T..GG.....C..... VM572* BMAV IV/V .....................................T.-------------- VM578* APIN, May IV/V .....................................T.-------------- VM591* BPIN, July IV/V .....................................T.-------------- VM 824 M. avidus A, Lesvos VI ...................................................A. VM561 APIN, May VII ................................C....T.........C..... VM616 ADUB, September VII ................................C....T.........C..... VM571 BDUB, August VII ................................C....T.........C....- VM557 BDUB, June VIII ................................C....T..............- S 409 M. avidus A, Lesvos VIII ................................C....T............... VM589 BDUR, June IX ..................A..................T..G......C..... VM605 BDUR, June X .......................CC............T..G......C..... VM563 BPIN, July XI .....................................T..G......CT.... VM566 AMOR, June XII ......T............C.T...............T.....C..TC.C.A. VM558 BDUB, June XIII ................................C....T.........C..... VM583 BDUB, July XIV .....................................T..G......C....- VM579 AMOR, April XIV .....................................T..G......C..... S 524 M. avidus B, France XV .....................................T.........C...A. VM580 AMOR, April XVI ................................C.C..T.........C..... S 532 M. avidus A, Lesvos XVII C.C.......C......C.C......T..........T.....CC..C.C.A. X14** M. bicolor , Spain XVIII ..CTCCTCCC.GCCTAA...TTT.CTTC.CCCCTCTTTTTCTCCCCTC.CCAT VM 826 M. bicolor, Spain XIX ..CTCCTCCC.GCCTAA...TTT.CTTC.CCCCT.TTTTTCTCCCCTC.CCAT VM 827 M. bicolour, Spain XX ..CTCCTCCC GCCTAA...TTT.CTTCGCCCCTCTTTTTCTCCCCTC.CCAT was initially identified as M. avidus B sensu Milankov et al. (2001) ( Mengual et al., 2006; Marcos-García et al., 2007).

We propose the name M. bicolor Gil Collado, 1930: 254 ( Merodon , as var. of spinipes ) (identity: valid species: comb. nov.) for the cryptic taxon from the Iberian Peninsula. Merodon bicolor was described from the three syntypes ( Gil Collado, 1930), as a variety of M. spinipes (Fabricius) from following localities: El Escorial, Cazzurro, Cercedilla, Arias, Somosiera, G. Menor. In depositary museum (Instituto Español de Entomología, Madrid, Spain), only one syntype was found. Based on this type specimen, the lectotype of this taxon was designated here: male ‘s pinipes v. bicolor / Cazurro’ (El Escorial, Spain) (MNCN). The lectotype shared the morphological characters with specimens from Spain analysed in this paper ( Tables 1, 2).

Wing size (F (2,498) = 65.57, P <0.001) and shape (Wilks’ L = 0.49; F (32,966) = 12.75; P <0.000) of two the available specimens from Spain were distinctly different from both M. avidus A and M. avidus B from the Balkan Peninsula. COI mtDNA sequence divergences between the Balkan and Spanish clades ranged from 4.93 to 6.0 ( Table 4). Thus, wing morphometrics and COI mtDNA haplotypes allowed clear delineation of these cryptic taxa.