Emesis ( Tenedia ) faria, Grishin, 2024
|
publication ID |
https://doi.org/10.5281/zenodo.14662420 |
|
publication LSID |
lsid:zoobank.org:pub:EFB3CF5F-6748-41D0-B905-E9CFC8F54D2C |
|
persistent identifier |
https://treatment.plazi.org/id/03BF8783-FF9E-FFDD-FF23-FD089958FEDA |
|
treatment provided by |
Felipe |
|
scientific name |
Emesis ( Tenedia ) faria |
| status |
new species |
Emesis ( Tenedia) faria Grishin, new species
http://zoobank.org/ FC8D5649-CD80-455B-9501-79C4C20959A3
( Fig. 3 View Figure 3 part, 29–32, 97–98)
Definition and diagnosis. Genomic analysis of two Emesis ( Tenedia Grishin, 2019) (type species Emesis tenedia C. Felder and R. Felder, 1861 ) specimens from Mexico ( Fig. 3 View Figure 3 aquamarine) reveals that they form a clade sister to both Emesis ( Tenedia) lupina Godman and Salvin, 1886 (type locality in Costa Rica) ( Fig. 3 View Figure 3 cyan) and Emesis ( Tenedia) tristis Stichel, 1929 , reinstated status (type locality in Mexico: Colima, syntype sequenced as NVG-18043E08) ( Fig. 3 View Figure 3 gray) and genetically differentiated from them at the species level, e.g., their COI barcodes differ by 4.6% (30 bp) from E. lupina and 5.2% (34 bp) from E. tristis . Therefore, these specimens represent a new species. This new species is similar in appearance to E. tristis and E. tenedia in its darker brown dorsal colors of males and more uniformly orange-brown ventral side with darker spots and streaks, but differs from them by slightly narrower wings than in E. tristis , straighter forewing costa and less hooked apex than in E. tenedia , better defined darker bands on dorsal forewing bordered by sharper dark-brown lines composed of curved streaks and dashes, and by brighter orange color of ventral side of wings. Due to the cryptic nature of this species and unexplored phenotypic variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: cne3200.4.3:A136T, cne13412.2.4:G67A, cne6684.2.15:C105T, cne9580.1.12:A234C, cne3815.7.4:A169C, and COI barcode: T50C, T56C, C271T, T463C, A541G, T571C.
Barcode sequence of the holotype. Sample NVG-18044H12, GenBank PQ203554, 658 base pairs: AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAACATCTCTAAGTCTATTAATTCGAATAGAATTAGGAACTTCAG GTTCTTTAATTGGTGATGATCAAATTTATAATACTATTGTCACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATT ATAATTGGAGGTTTTGGTAACTGATTAGTACCATTAATACTAGGAGCTCCAGATATAGCTTTCCCACGAATAAATAATATAAGAT TTTGATTATTACCTCCCTCATTAATCTTATTAATTTCAAGAAGAATCGTAGAAAATGGAGCTGGAACAGGATGAACAGTGTACCC CCCACTTTCTTCTAATATCGCTCATGGAGGATCATCAGTAGATTTAGCTATTTTTTCTTTACATTTAGCAGGTATTTCATCTATT TTAGGAGCAATTAATTTTATTACTACTATTATTAACATACGAATTAATAATTTATCATTTGATCAAATACCTCTTTTCATTTGAT CAGTAGGTATCACAGCACTTTTACTTTTGCTATCTTTACCTGTTTTAGCTGGAGCTATCACTATACTATTAACAGATCGTAATCT AAATACATCATTTTTTGATCCTGCAGGAGGAGGAGACCCAATTTTATATCAACACTTATTT
Type material. Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA ( USNM), illustrated in Fig. 29–30 View Figures 27–48 , bears the following six printed (text in italics handwritten) rectangular labels, five white: [Tamps, Mexico | Gomez Farias | leg. E.C.Knudson | 12-X-1976], [DNA sample ID: | NVG-18044H12 | c/o Nick V. Grishin ], [DNA sample ID: | NVG-23114G12 | c/o Nick V. Grishin ], [genitalia | NVG240817-17 | Nick V. Grishin ], [USNMENT | {QR Code} | 01466413], and one red [ HOLOTYPE ♂ | Emesis (Tenedia) | faria Grishin]. The first NVG number corresponds to a sampled leg, while the second refers to DNA extraction from the abdomen, followed by genitalia dissection. Paratype: 1♂ NVG-18044H03, USNMENT 01466404 Mexico: Hidalgo, Cuesta Colorada, 21-Jul-1981, W. H. Howe leg. [ USNM] ( Fig. 31–32 View Figures 27–48 ).
Type locality. Mexico: Tamaulipas, Gomez Farías.
Etymology. The name is formed from the name of the type locality: [Gomez] Faria [s], and is treated as a feminine noun in apposition.
Distribution. Eastern Mexico.
| USNM |
Smithsonian Institution, National Museum of Natural History |
| V |
Royal British Columbia Museum - Herbarium |
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
|
Kingdom |
|
|
Phylum |
|
|
Class |
|
|
Order |
|
|
Family |
|
|
Genus |
