Emesis ( Aphacitis ) aurichica, Grishin, 2024
|
publication ID |
https://doi.org/10.5281/zenodo.14662420 |
|
publication LSID |
lsid:zoobank.org:pub:EFB3CF5F-6748-41D0-B905-E9CFC8F54D2C |
|
persistent identifier |
https://treatment.plazi.org/id/03BF8783-FF96-FFD2-FF23-FA709F00FC75 |
|
treatment provided by |
Felipe |
|
scientific name |
Emesis ( Aphacitis ) aurichica |
| status |
new species |
Emesis ( Aphacitis) aurichica Grishin, new species
http://zoobank.org/ D421A535-0198-4C66-9E64-5E983B48351F
( Fig. 5 View Figure 5 part, 59–62, 119–120)
Definition and diagnosis. This is the northernmost species of the five revealed by genomic sequencing of the subgenus Aphacitis Hübner, [1819] , as detailed above. This new species ( Fig. 5 View Figure 5 green) is sister to all other seven species in the clade with Emesis ( Aphacitis) aurimna (Boisduval, 1870) ( type locality in Colombia) and most differentiated genetically from others, e.g., its COI barcode differs by 3.2% (21 bp) from E. aurimna . This new species is phenotypically similar to others in the E. aurimna clade and differs from its relatives by a combination of the following characters in female: white forewing subapical area is less extensive and stronger separated from the wing margins by the ground brown color, both above and beneath, the ventral side is with submarginal inverted crescents connected with each other, not clearly separated as in E. aurimna , and dark web pattern is generally more extensive ventrally. Males have a stronger postdiscal dark band from costa to tornus on dorsal forewing, i.e., the postdiscal band visually merges into the submarginal band instead of bending basad as in other species; this bent portion from vein M 1 to the inner margin is present but is usually not as prominent as the submarginal branch; subapical forewing area is paler, but not strongly frosted with white scales, and ventral side is brighter orange compared to other species. Due to the cryptic nature of this species and unexplored phenotypic variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: cne16034.1.2:A125G, cne16034.1.2:A735C, cne6734.6.2:A57G, cne6734.6.2:C78T, cne 2296.1.3:A34G, and COI barcode: T226C, A229G, T250C, T550C, T574C.
Barcode sequence of the holotype. Sample NVG-18044B04, GenBank PQ203562, 658 base pairs: AACATTATACTTTATTTTTGGAATTTGATCAGGGATAGTCGGCACATCTTTAAGTTTATTAATTCGAATAGAATTAGGAACCTCAG GTTCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCCCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATT ATAATCGGAGGATTTGGTAACTGATTAGTTCCATTAATACTAGGAGCACCTGACATGGCTTTCCCACGAATAAATAACATAAGAT TTTGACTTTTACCACCATCATTAATTTTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTGTACCC CCCACTTTCATCTAATATTGCCCATGGAGGAGCTTCAGTTGATTTAGCTATCTTTTCCCTTCATTTAGCTGGTATTTCATCTATT TTAGGAGCAATTAATTTTATCACAACAATCATTAATATACGTATTAACAATATGTCATTTGATCAAATACCATTATTTGTCTGAT CTGTTGGAATTACAGCCCTTTTACTTTTATTGTCTCTCCCAGTTTTAGCTGGAGCTATTACCATATTATTAACAGATCGTAATTT AAATACATCTTTTTTTGACCCTGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTT
Type material. Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA ( USNM), illustrated in Fig. 59–60 View Figures 49–62 , bears the following six printed rectangular labels, five white: [ Riodinidae VIII-2-1988 | Emesis lucinda M | Agua Azul, CHIS, Mexico], [DNA sample ID: | NVG-18044B04 | c/o Nick V. Grishin ], [DNA sample ID: | NVG-23114H07 | c/o Nick V. Grishin ], [genitalia | NVG240817-26 | Nick V. Grishin ], [USNMENT | {QR Code} | 00940155], and one red [ HOLOTYPE ♂ | Emesis (Aphacitis) | aurichica Grishin]. The first NVG number corresponds to a sampled leg, while the second refers to DNA extraction from the abdomen, followed by genitalia dissection. Paratype: 1♀: NVG-18095C02 Costa Rica (no detailed locality), 1903 [ MTD] ( Fig. 61–62 View Figures 49–62 ).
Type locality. Mexico: Chiapas, Agua Azul.
Etymology. The name for this E. aurimna relative from Chiapas and Costa Rica is formed as a fusion: auri [mna] + Chi [apas] + [Costa Ri] ca and is treated as a feminine noun in apposition.
Distribution. Currently known from southern Mexico ( Chiapas) and Costa Rica.
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
|
Kingdom |
|
|
Phylum |
|
|
Class |
|
|
Order |
|
|
Family |
|
|
Genus |
