Oecleus sergipensis, Bartlett & Passos & Silva & Diniz & Dollet, 2018

Bartlett, Charles R., Passos, Eliana Maria Dos, Silva, Flaviana Gonçalves Da, Diniz, Leandro Eugenio Cardamone & Dollet, Michel, 2018, A new species of Oecleus Stål (Hemiptera: Fulgoroidea: Cixiidae) from coconut in Brazil, Zootaxa 4472 (2), pp. 358-364 : 360-363

Oecleus sergipensis n. sp.

( Figures 1–12 )

Type locality. Itaporanga D’Ajuda , Sergipe, Brazil.

Diagnosis. A pale species, ~ 5–6 mm, with 5 carinae on the mesonotum and a projected head. Male terminalia with a broad, rounded ventral lobe of the pygofer, 3 processes on the phallotheca (2 subbasal—1 on each side—and one near midlength on right side), and 5 flagellar processes. Anal tube very broad and truncate apically, strongly concave ventrally.

Description. Color. Ground color of body tan to yellowish-white ( Figs. 1–3 ); legs brownish white; wings clear. Structure. Body length (including wings) males x‾= 5.19 mm (4.69–5.57 mm, n=5); females x‾= 5.56 mm (5.18–5.82 mm, n=3). In lateral view, head prolonged about 2/3 length of eyes, acutely pointed, and slightly inclined distally ( Fig. 5 ). Eyes oval, long axis approximately parallel to vertex, distinctly emarginate near antennae. Vertex narrow ( Fig. 1 ), median carinae absent, lateral carinae closely approximated between eyes, distinctly broader distally; apex of head with carina at fastigium. Ocelli present with lateral ocelli below eyes, median just above midline of frontoclypeal suture on median carina of frons. Face with frons elongate ( Fig. 3 ), narrowing slightly from frontoclypeal suture to fastigium; median carinae evident from frontoclypeal suture to above eyes where it becomes obsolete; clypeus with median carina present. Pronotum with anterior margin weakly concave, posterior margin deeply "U" shaped, medially very short and obscuring median carina; lateral carinae diverging, poorly developed. Mesonotum midline longer than head plus pronotum; bearing 5 pale carinae, 3 distinct, lateralmost weak; all nearly straight and approximating posterior mesonotum margin. Wings clear ( Fig. 4 ), veins embrowned with conspicuous pustules. Combined veins Sc+R+MP with long stem extending from leading margin of the basal cell ( Fig. 12 ); Sc+R branched from MP at about 1/3rd length of clavus; combined veins Sc+R with 5 branches reaching wing margin, MP with 5 terminals; CuA apparently with 2 branches; PCu joining with A1 near midlength of clavus (distad of fork of Sc+R and MP).

Male terminalia. Pygofer in lateral view distinctly elongate ventrally and strongly narrowing dorsally ( Figs. 6 , 9 ). Median lobe of pygofer broad in ventral view narrowing distally, rounded apically. Phallotheca with 3 processes ( Figs. 6, 8 , 9–11 ), one elongate process just beyond mid-length of phallotheca laterally projected from right side and a pair of subbasal projections closely oppressed to the phallotheca; flagellum (endosoma) with 5 elongate processes—1 apical, 2 subapical on right side; 2 subbasal (one on each side). Anal tube in lateral view strongly concave ventrally, distally very broad, apex in lateral view truncate with slight concave emargination.

Note. Compared to species illustrated by Caldwell (1944), O. sergipensis would appear to be closest to O. pellucens Fowler 1904 , but differs most obviously in that O. sergipensis has an anal tube that is broader distally, a broader and more regularly tapered ventral process on the pygofer, and the presence of a process near the middle of the phallotheca on the right side in O. sergipensis (longer and apical in O. pellucens ).

Plant associations: Arecaceae : coconut ( Cocos nucifera L.) and date palm ( Phoenix L).

Distribution: Brazil (Sergipe).

Etymology. The specific name is a reference to Sergipe State in Brazil where the species was detected, and the name is considered indeclinable.

Specimens examined. Holotype male “ Brazil, Sergipe / Itaporanga D'Ajuda, / Eliana Passos ; 19 April 2016 / Aspirated from Coconut // Holotype / Oecleus sergipensis / Bartlett & Passos” ; Paratypes, Itaporanga D’Ajuda [26 November 2015] (4 males, 1 female, MPEG), Itaporanga D’Ajuda [26 November 2015] (4 males, 1 female, CPATU); Neópolis [17 December 2015] (3 males, MPEG); Aracaju [23 November 2015] (10 males) [representatives used for molecular analysis]).

Sequence data. A total of 587 bp of CO1 sequence data was obtained and accessioned to GenBank (Accession No.: MH266780 ). The available sequence data on GenBank does not include homologous sequence data for Oecleus . The closest match for the sequence data using a BLAST search was Haplaxius crudus (accession HM017492.1) with an 83% identity and 82% query coverage match. This match supports a tribal level relationship among Oecleus and Haplaxius , but also demonstrates that no similar sequence data is present in GenBank for Oecleus . The sequence data obtained in this study is given as follows (5’–3’):

ccaaaaaacttatatcctcatcctaccagggtttggcttaatctctcatatcattatgcaagaaacaggtaaaaaggaaacatttggatcaatcggaataatttatgcaataa ttgcaattggagcattagggtttgtcgtatgagcacatcatatattcacagtaggaatagacattgatacccgagcttactttacatcagcaaccataatcatcgcagtacc aactggaattaaaatttttagatgaatagcaaccatatacggaacaaaaataaagttttcacctcaaatactatgagcatcaggatttgtatttttattccccatgggcggatt aacaggagtaatcttagccaattcatcaattgacatcatccctacatgacccatactatgtagttgcacattttttttttcgtattatcaataggagccccattccctcttatagg

aagattcatccactgctaccccctattccccacgaatatacccaaaaaaaaaaggattactacttccccccctcctaatatttacaggagccccccttatccttttcccccc ccccttcttaccaagccctc

Remarks. In Kramer (1977), this species might key between Oecleus rhion Kramer, 1977 and O. piperatus Ball & Klingenberg, 1935 , if the direction of “shaft [phallotheca] with acute projection on right side near base or middle” is followed; however, O. sergipensis bears little resemblance to these species and the projection on the phallotheca is different in nature from those illustrated by Kramer (1977) for those two species. Ignoring this, Kramer’s key at couplet 5 might be followed in the direction of ‘[aedeagal] shaft with three processes’, except that in all cases, the processes are near the apex of the phallotheca; ignoring these, O. sergipensis might key to Oecleus snowi Ball, 1905 , which is similar in that it is a ‘tawny’ species (as opposed to black); however, O. snowi is a large species (Kramer reported males 6.0–7.0 mm., females 7.0– 8.5 mm), and differs from O. sergipensis in many details. None of the species illustrated in Caldwell (1944) show subbasal processes on the phallotheca of the aedeagus.

Figures

FIGURE 12. Oecleus sergipensis, wing venation; A1—first anal vein; CuA—anterior cubitus; CuP—posterior cubitus; imintermedial transverse veinlet; ir—interradial transverse veinlet; m-cu—medio-cubital transverse veinlet; MP—posterior media; PCu—postcubitus; r-m—radio-medial transverse veinlet; RP—posterior radius; ScP—posterior subcosta.

FIGURES 1–8. Oecleus sergipensis, all male except 4 female; 1, dorsal view; 2, lateral view; 3, frontal view; 4, left wing; 5, head and thorax, left lateral view; 6, male terminalia, left lateral view; 7, male terminalia, left ventrolateral view (note ventral lobe of pygofer); 8, male terminalia, ventrocaudal view (note closely oppressed spines of phallotheca).

FIGURES 9–11. Oecleus sergipensis, male terminalia; 9, terminalia, left lateral view; 10, aedeagus and flagellum, right lateral view; 11, phallotheca apex and flagellum, caudal view.