Cynea ( Nycea ) quada Grishin, 2023
|
publication ID |
https://doi.org/10.5281/zenodo.10396362 |
|
DOI |
https://doi.org/10.5281/zenodo.10622081 |
|
persistent identifier |
https://treatment.plazi.org/id/03810139-FFEB-BB64-C0CA-FFB0E736B7C3 |
|
treatment provided by |
Felipe |
|
scientific name |
Cynea ( Nycea ) quada Grishin |
| status |
sp. nov. |
Cynea ( Nycea) quada Grishin , new species
https://zoobank.org/ 6A719582-3B76-4FD4-9C4C-FEC6DF85C27E
( Fig. 5 part, 115–116, 345–347)
Definition and diagnosis. Phylogenetic trees reveal that a specimen from Ecuador identified as Cynea ( Cynea) diluta (Herrich-Schäffer, 1869) ( type locality not specified) or Cynea bistrigula (Herrich-Schäffer, 1869) ( type locality not specified) is more related to Cynea ( Nycea) erebina (Möschler, 1879) , but shows prominent genetic differentiation from the latter species ( Fig. 5): e.g., their COI barcodes differ by 2.6% (17 bp), and therefore the Ecuadorian specimen represents a new species. This new species keys to C. popla Evans, 1955 ( type locality in Trinidad) (L.7.8) in Evans (1955) and differs from its relatives by narrower forewing spots, four yellowish dots on the ventral hindwing: one in the middle and three in the postdiscal area ( Fig. 115–116), more concave sides of uncus in dorsal view, arms not separated but with a shallow notch between them, their distal margin relatively flat and angled on the sides, gnathos arms thinner, shorter, strongly sclerotized, sacculus distally with a couple of small teeth, harpe terminally rounded, continues into a rounded thumb-like finely serrated process directed anterodorsad, situated inner from ampulla and covered with it in outer lateral view ( Fig. 345–347). Due to the cryptic nature of this species, most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly653.3.7:G45A, aly798.8.27:G99A, aly1651.42.3:T36A, aly525.64.4:C90T, aly127.90.1:T201C, aly390.26.4:G93G (not A), aly4265.5.1:T96T (not C), aly531.44.1:C1237C (not T), aly2011.20.4:G135G (not A), aly18826.6.2:A102A (not G), and COI barcode: A100C, A253G, T268C, 325C, T500C.
Barcode sequence of the holotype. Sample NVG-18119D03, GenBank OR837676, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGTATATTAGGAACTTCCTTAAGATTATTAATTCGTACAGAATTAGGTAACCCAGGATCATTAATT GGCGATGATCAAATTTATAATACTATTGTAACAGCTCATGCCTTTATTATAATTTTTTTTATAGTTATACCTATTATAATCGGAGGATTTGGTAATT GATTAGTACCTTTAATATTAGGAGCTCCTGATATAGCTTTCCCCCGAATAAATAACATGAGATTTTGAATACTCCCACCATCTTTAATACTACTAAT TTCAAGAAGAATTGTAGAAAATGGTGCAGGAACCGGTTGAACAGTTTACCCCCCTCTTTCATCTAATATTGCCCATCAAGGAAGTTCAGTTGATTTA GCAATTTTTTCCCTTCATTTAGCGGGAATTTCTTCTATTTTAGGGGCTATCAATTTTATTACAACAATTATTAATATACGAATCAATAATATATCAT TTGATCAAATATCCCTATTTATTTGATCAGTAGGTATTACAGCACTTTTATTACTTTTATCCTTACCAGTATTAGCAGGAGCTATTACTATACTTTT AACAGATCGAAATTTAAATACTTCTTTTTTTGATCCTGCAGGAGGAGGAGATCCTATTTTATATCAACATTTATTT
Type material. Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA ( USNM), illustrated in Fig. 115–116, bears the following six rectangular labels, five white: [ ECUADOR: Napo Prov | 4 km Tena-Pano Rd. | 1° 02′S 77° 50′W | 600m 27 Sep 1990 | S S Nicolay leg], [ ♂ genitalia | slide/vial # | H1068 | Prep. S.S. Nicolay], [ Cynea ♂ | bistrigula | Det. H-S. | S.S. Nicolay], [DNA sample ID: | NVG-18119D03 | c/o Nick V. Grishin], [USNMENT | { QR Code} | 01531867], and one red [ HOLOTYPE ♂ | Cynea quada | Grishin]. GoogleMaps
Type locality. Ecuador: Napo Province, km 4 of Tena-Pano Rd., elevation 600 m, GPS −1.033, −77.833.
Etymology. The name is for the four points on each ventral hindwing and four major spots on both forewings taken together and also for the type locality in Ecuador. The name is a noun in apposition.
Distribution. Currently known only from the holotype collected in Napo, Ecuador.
| USNM |
Smithsonian Institution, National Museum of Natural History |
| V |
Royal British Columbia Museum - Herbarium |
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
|
Kingdom |
|
|
Phylum |
|
|
Class |
|
|
Order |
|
|
Family |
|
|
Genus |
