Niconiades victoria Grishin, 2023
publication ID |
https://doi.org/10.5281/zenodo.10396362 |
persistent identifier |
https://treatment.plazi.org/id/03810139-FFE7-BB69-C0CA-FBA5E01EB08C |
treatment provided by |
Felipe (2024-02-05 21:30:58, last updated by GgImagineBatch 2024-02-05 21:41:28) |
scientific name |
Niconiades victoria Grishin |
status |
sp. nov. |
Niconiades victoria Grishin , new species
https://zoobank.org/ 216DED72-3642-44BA-B553-22AD2C42EFF6
( Fig. 5 part, 129–130, 361–363)
Definition and diagnosis. Genomic analysis of specimens we identified as Niconiades nikko Hayward, 1948 (type locality Argentina: Misiones) reveals their partitioning into two clades genetically differentiated in the Z chromosome ( Fig. 5a) but not in the mitogenome ( Fig. 5b). Due to prominent genetic differentiation in the nuclear genome, the two clades represent species-level taxa, and the North American species is new. This new species keys to N. nikko (O.11.6) in Evans (1955) and differs from it by typically weaker defined whitish band on the ventral hindwing and more extensive greenish-yellow overscaling ( Fig. 130). Due to the cryptic nature of this species and significant wing pattern variability, most reliable identification is achieved by DNA and a combination of the following nuclear genomic base pairs is diagnostic: aly366.12.1:A1164G, aly383.17.7:C1401T, aly383.17.7:G1869A, aly 1651.5.1:T1086C, aly694.1.1:A441C. There are no consistent differences between the new species and N. nikko in COI barcodes.
Barcode sequence of the holotype. Sample NVG-19013C03, GenBank OR837683, 658 base pairs: AACTTTATATTTTATTTTTGGTATTTGGGCTGGAATATTAGGAACTTCCCTCAGTTTATTAATTCGTACAGAATTAGGTAATCCAGGATCTTTAATT GGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATT GATTAGTACCTTTAATATTAGGAGCACCTGATATGGCTTTCCCCCGAATAAATAATATAAGATTTTGAATATTACCCCCTTCTTTAATATTATTAAT CTCAAGAAGAATTGTAGAAAATGGTGCTGGAACTGGATGAACAGTTTACCCCCCTCTATCCTCTAATATTGCCCACCAAGGATCATCAGTTGATTTA GCAATTTTCTCTCTTCATCTAGCCGGAATTTCCTCAATTCTAGGAGCAATTAATTTTATTACTACAATCATTAATATACGAATTAGTAATATATCAT TTGATCAAATACCTTTATTTGTTTGATCTGTAGGTATTACAGCATTATTATTACTTTTATCTTTACCAGTTTTAGCAGGGGCTATTACTATACTTCT
TACAGATCGAAATTTAAACACTTCATTTTTTGATCCTGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT
Type material. Holotype: ♂ deposited in the Texas A&M University Insect Collection, College Station, TX, USA ( TAMU), illustrated in Fig. 129–130, bears the following seven rectangular labels: six white [ MEXICO: | TAMAULIPAS | Rancho Pico de Oro | vic. of Los Kikos], [ex larva | 26 Dec 1974 | Roy O. Kendall | and C. A. Kendall], [Larval foodplant: | GRAMINEAE | Bambusa vulgaris | Schrad. | (foliage -)], [ Niconiades ♂ | nikko | Hayward | det.H.A.Freeman], [ HESPERIIDAE : | Hesperiinae : | Niconiades nikko | ♂ Hayward, 1948 | Det. R. O. Kendall | [M. & B. No. 264.3]], [DNA sample ID: | NVG-19013C03 | c/o Nick V. Grishin], and one red [HOLOTYPE ♂ | Niconiades | victoria Grishin ]. Paratypes: 2♂ and 1♀: 1♀ NVG-18012C11, USNMENT_ 01450288 Mexico: San Luis Potosi, Cd. Valles, 15-Oct-1976, E. C. Knudson leg., genitalia X-3289 J. M. Burns 1992 [ USNM], 1♂ NVG-20057B04 Mexico: Chiapas (no other data), genitalia vial NVG 231118-03 [ TMMC] ( Fig. 361–363), and 1♂ NVG-18012C12, USNMENT_01450289 Honduras, San Pedro Sula, 24-Dec-1971, Robert D. Lehman leg., genitalia X-3249 J. M. Burns 1992 [ USNM].
Type locality. Mexico: Tamaulipas, vic. Los Kikos, Rancho Pico de Oro.
Etymology. In Greek, νίΚη (nike) is the word for “victory” which sounds similar to the name N. nikko , the sister species. In Latin, victory is victoria , the word used as this species’ epithet. The name is a noun in apposition.
Distribution. From eastern Mexico to Guatemala, at least.
Evans WH. 1955. A catalogue of the American Hesperiidae indicating the classification and nomenclature adopted in the British Museum (Natural History). Part IV. Hesperiinae and Megathyminae. The Trustees of the British Museum (Natural History); London. v + 499 p., pl. 54 - 88.
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
Kingdom |
|
Phylum |
|
Class |
|
Order |
|
Family |
|
Genus |