Amblyscirtes ( Mastor ) chrysomisa Grishin, 2023
|
publication ID |
https://doi.org/10.5281/zenodo.10396362 |
|
persistent identifier |
https://treatment.plazi.org/id/03810139-FFE2-BB6E-C0CA-FA69E1D7B613 |
|
treatment provided by |
Felipe |
|
scientific name |
Amblyscirtes ( Mastor ) chrysomisa Grishin |
| status |
sp. nov. |
Amblyscirtes ( Mastor) chrysomisa Grishin , new species
https://zoobank.org/ 713888C4-2DD4-4996-B0B7-05226B4462D0
( Fig. 6 part, 147–148, 372–374)
Definition and diagnosis. Phylogenetic trees reveal that a number of specimens identified as Amblyscirtes anubis Godman, 1900 ( type locality in Mexico: Guerrero) show prominent genetic differentiation from it and from their sister species Amblyscirtes chrysoplea new species ( Fig. 6): e.g., their COI barcodes differ from the latter species by 4% (26 bp), and therefore represent a new species. This new species keys to A. anubis (N.2.21) in Evans (1955) but differs from its closest relatives in having yellow-orange forewing fringes, dark-brown hindwing fringes, and ventral hindwing essentially unspotted (better defined, rounder ventral hindwing spots are typical for A. anubis ). Due to the cryptic nature of this species, most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly390.21.1:C54T, aly 2011.1.3:C213T, aly2487.17.5:T57A, aly 2275.11.10:G75C, aly 1158.9.10:C114T, and COI barcode: 88C, T103C, 268C, T349G, T386C, T553G.
Barcode sequence of the holotype. Sample NVG-18063H02, GenBank OR837688, 658 base pairs: AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATACTAGGAACTTCATTAAGATTATTAATTCGTACAGAATTAGGAAACCCTGGCTCATTAATT GGAGACGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATT GATTAGTTCCTTTAATATTAGGGGCCCCTGATATAGCTTTCCCACGGATAAATAATATAAGATTTTGAATACTCCCCCCATCTCTAATACTTTTAAT TTCAAGAAGAATTGTAGAAAATGGTGCAGGAACAGGATGAACAGTGTACCCCCCTCTGTCATCCAATATTGCCCATCAAGGATCATCTGTTGATCTA GCTATTTTTTCCCTTCATTTAGCAGGAATTTCTTCAATTTTAGGAGCAATTAATTTTATTACTACAATTATTAATATACGAGTTAGAAACATATCGT
TTGATCAAATACCCCTATTTGTTTGATCTGTAGGTATTACTGCTTTATTATTACTTTTATCTTTACCGGTATTAGCAGGTGCTATCACAATACTCCT TACCGATCGAAATTTAAATACTTCATTTTTTGATCCTGCTGGAGGAGGGGATCCAATTTTATATCAACATTTATTT
Type material. Holotype: ♀ deposited in the National Museum of Natural History, Smithsonian Institution, Washington , DC, USA ( USNM), illustrated in Fig. 147–148, bears the following four rectangular labels, three white: [ MEXICO: CHIAPAS | nr. Navenchauc | c. 8000 ft 4-VII-1992 | J. Kemner & A. Vasquez], [DNA sample ID: | NVG-18063H02 | c/o Nick V. Grishin], [USNMENT | { QR Code} | 01466220], and one red [ HOLOTYPE ♀ | Amblyscirtes (Mastor) | chrysomisa Grishin ] . Paratypes: 4♂♂ and 1♀ from Mexico: 1♂ NVG-18063G10, USNMENT_01466216 no data, Collection Wm Schaus , old, genitalia X-2556 J.M.Burns 1988 [ USNM] ; 1♀ NVG-18063G11, USNMENT_01466217 Veracruz, Xalapa, old [ USNM] ; 1♂ NVG-19043A01, AMNH _ IZC 00337914 About AMNH Mexico: Hidalgo, Apulco , Apr-1952, T. Escalante leg. [ AMNH] ; 1♂ NVG-18063H01, USNMENT_01466219 Chiapas, nr. Navenchauc , c. 8000 ft, 4-Jul-1992, J. Kemner and A. Vasquez [ USNM] ; 1♂ NVG-19043A02, AMNH _ IZC 00337915 About AMNH Chiapas, Ochuc, Rancho San Ramon , 7-Jul-1975, Peter Hubbell leg. [ AMNH] .
Type locality. Mexico: Chiapas, nr. Navenchauc, elevation about 8000 ft.
Etymology. The name is formed from the Greek Χρυσός (chrysós), meaning gold, and μισα (misa), meaning half. It is given for the forewings with orange fringes and hindwings with dark fringes. The name is a noun in apposition.
Distribution. Southeastern Mexico.
Amblyscirtes ( Mastor) repta Evans, 1955 is a species distinct from Amblyscirtes ( Flor) florus (Godman, 1900)
Genomic sequencing of the holotype of Repens repta Evans, 1955 (type locality Mexico: Jalisco, Guadelajara) currently a junior subjective synonym of Amblyscirtes ( Flor) florus (Godman, 1900) (type locality in Mexico: Nayarit, holotype sequenced as NVG-18083E07) reveals that these two taxa are not monophyletic and R. repta is sister to the clade with Amblyscirtes ( Mastor) anubis Godman, 1900 , the type species of the subgenus Mastor Godman, 1900 ( Fig. 6). Therefore, we reinstate R. repta as a valid species and transfer it to the subgenus Mastor : Amblyscirtes ( Mastor) repta Evans, 1955 .
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
