Aguna esmeralda Grishin, 2023
|
publication ID |
https://doi.org/10.5281/zenodo.10396362 |
|
DOI |
https://doi.org/10.5281/zenodo.10621997 |
|
persistent identifier |
https://treatment.plazi.org/id/03810139-FFCF-BB41-C0CA-F921E033B6BC |
|
treatment provided by |
Felipe |
|
scientific name |
Aguna esmeralda Grishin |
| status |
sp. nov. |
Aguna esmeralda Grishin , new species
https://zoobank.org/ 81C0476E-A9A8-4A6E-8EE9-F25C3C13130F
( Fig. 1 part, 29–30, 241–242)
Definition and diagnosis. A species related to Aguna glaphyrus (Mabille, 1888) ( type locality in Brazil: Santa Catarina ), Aguna longicauda Austin and O. Mielke, 1998 ( type locality in Brazil: Rondônia), and Aguna spicata Austin and O. Mielke, 1998 ( type locality in Brazil: Rondônia) ( Fig. 1), but genetically differs from them more than they are from each other, e.g., COI barcode difference from A. glaphyrus is 5% (33 bp). Phenotypically can be identified by the contrasting tint of upperside green overscaling: yellower on the forewing and bluer on the hindwing ( Fig. 29), short and stubby tails, nearly oval valva (when taken together with harpe), longer than in A. glaphyrus and A. spicata (among others), and separated from harpe only with a small notch, harpe rounded distad rather than narrowing, sacculus expanded distad. Due to the cryptic nature of this species, most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly671.26.9:C88T, aly671.16.4:T181A, aly 1468.8.8:A146G, aly 1468.8.8:T156C, aly 1340.1.1:C1566T, and COI barcode: A148G, A181T, TC208, T430G, T523C.
Barcode sequence of the holotype. Sample NVG-18017A03, GenBank OR837634, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAATTGGAACTTCATTAAGATTACTTATTCGAACTGAATTAGGAACCCCCGGATCTTTAATT GGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATGATTTTTTTTATAGTAATACCTATTATAATTGGTGGATTTGGAAATT GACTTGTACCTCTCATACTAGGAGCCCCTGATATAGCATTCCCCCGAATAAATAATATAAGATTTTGACTTTTACCCCCCTCCTTAACTCTTTTAAT CTCTAGAAGCATTGTAGAAAATGGTGCAGGCACAGGATGAACAGTTTATCCCCCTCTTTCATCTAATATTGCACATCAGGGAGCTTCCGTAGATTTA GCAATTTTTTCTTTACATTTAGCAGGAATTTCCTCTATTCTGGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAATAATTTATCTT TCGATCAAATATCTTTATTCATTTGAGCAGTTGGTATCACTGCATTATTACTATTACTTTCTTTACCTGTTTTAGCAGGAGCTATTACAATATTATT AACAGATCGAAACTTAAACACTTCATTCTTTGATCCTGCAGGAGGAGGTGATCCTATTTTATATCAACATTTATTT
Type material. Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution , Washington, DC, USA ( USNM), illustrated in Fig. 29–30, bears the following four rectangular labels, three white: [ ECUADOR: Esmeraldas: | Río Chuchuví, km. 12.5 Lita- | San Lorenzo rd. 800-900m | 0° 53.01’ N 78° 30.90′ W | I.2001 I.Aldas leg.], [DNA sample ID: | NVG-18017A03 | c/o Nick V. Grishin], [USNMENT | { QR Code} | 01450831], and one red [ HOLOTYPE ♂ | Aguna esmeralda | Grishin] GoogleMaps . Paratypes: 4♂♂ from Ecuador: Esmeraldas Province: 2♂♂ from the type locality: NVG-18017A04 USNMENT_01450832 the same data as the holotype, but collected in Mar-2001 [ USNM] GoogleMaps ; and NVG-18066C 08 Oct-2012, ex coll. M. Büche [EBrockmann]; 1♂ NVG-18016H04, USNMENT_01450823 Km 18.5 San Mateo-Pto. Libre Road, Zapatta Hilltop, 500 m, GPS 0.884500, −79.540333, 6-Mar-2001, D. H. Ahrenholz leg. [ USNM] GoogleMaps ; 1♂ NVG-18065E11 Durango, 500-800 m, Mar-Jun-2011, ex coll. M. Büche [EBrockmann].
Type locality. Ecuador: Esmeraldas Province, Río Chuchuví, km. 12.5 Lita-San Lorenzo Road, elevation 800– 900 m, GPS 0.883500, −78.515000.
Etymology. The name is formed from the Esmeraldas Province, the type locality of this species. The name is a noun in apposition, originating from a Greek word meaning emerald, which also nicely reflects the emeraldgreen color on the dorsal hindwing of this species.
Distribution. Currently known from northwestern Ecuador.
| USNM |
Smithsonian Institution, National Museum of Natural History |
| V |
Royal British Columbia Museum - Herbarium |
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
|
Kingdom |
|
|
Phylum |
|
|
Class |
|
|
Order |
|
|
Family |
|
|
Genus |
