Milanion ( Milanion ) laricus Grishin, 2023
|
publication ID |
https://doi.org/10.5281/zenodo.10396362 |
|
DOI |
https://doi.org/10.5281/zenodo.10622011 |
|
persistent identifier |
https://treatment.plazi.org/id/03810139-FFC8-BB48-C0CA-F9CEE07CB6E4 |
|
treatment provided by |
Felipe |
|
scientific name |
Milanion ( Milanion ) laricus Grishin |
| status |
sp. nov. |
Milanion ( Milanion) laricus Grishin , new species
https://zoobank.org/ 5BD7C016-6141-4D71-BAAB-DD8F18887811
( Fig. 2 part, 45–46, 258–259)
Definition and diagnosis. Several specimens from Ecuador identified as Milanion alaricus (Plötz, 1884) (type locality in Brazil: Bahia) were not closely related to the syntype of M. alaricus ( Fig. 2) and formed a clade distinct from all other species of the genus. Therefore, they represent a new species. This new species keys (incompletely) to M. alaricus (E.46.6) in Evans (1953) and differs from its relatives by a vestigial (or lacking) white spot in forewing cell CuA 2 -1A+2A, spot at the base of cell M 3 -CuA 1 is larger, more triangular than rounded (as in M. alaricus ) with its distal part protruding distad of the spot in the cell CuA 1 -CuA 2, ventral hindwing area by costa in basal two-thirds is not white, but is pale-brown, not the same dark color as the brown marginal wide border. This species is not cryptic and is diagnosed reliably by phenotype. In DNA, a combination of the following base pairs is diagnostic in the nuclear genome: aly1313.22.1:G201A, aly923.23.1:T1497C, aly15192.3.7:G100A, aly 1405.11.14:C72T, aly 2095.5.1:C135T, and COI barcode: T133A, T301C, A577G, A592G, A628T.
Barcode sequence of the holotype. Sample NVG-18018H07, GenBank OR837642, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAGTAGGAACTTCTTTAAGTTTATTAATTCGAACTGAATTAGGAAACCCAGGATCTTTAATT GGAGATGATCAAATTTATAATACTATTGTAACTGCACATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGTGGATTTGGAAATT GATTAGTACCATTAATATTAGGAGCCCCAGATATAGCTTTCCCTCGAATAAATAATATAAGATTTTGATTATTACCCCCATCTCTTATATTATTAAT TTCAAGAAGCATTGTGGAAAATGGTGCAGGAACTGGATGAACAGTTTATCCCCCCCTTTCAGCCAATATTGCCCACCAAGGTTCATCAGTAGATTTA GCAATCTTTTCTTTACATTTAGCTGGAATTTCTTCAATTCTAGGAGCTATTAATTTTATCACCACTATTATTAACATACGAGTAAATAACTTATCAT TTGATCAAATACCATTATTTGTATGAGCAGTAGGAATTACTGCACTACTTTTATTGTTATCTTTACCTGTATTAGCGGGTGCTATTACTATGTTATT AACTGATCGGAATTTAAATACATCATTTTTTGACCCAGCAGGAGGTGGAGATCCAATTTTATATCAACATCTATTT
Type material. Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution , Washington, DC, USA ( USNM), illustrated in Fig. 45–46, bears the following four rectangular labels, three white: [ ECUADOR: Napo Pr. | Jatun Sacha Biol St. | 1° 4.0′S 77° 37.0′W | 13 Nov. 1992. 450m. | S. S. Nicolay, leg.], [DNA sample ID: | NVG-18018H07 | c/o Nick V. Grishin], [USNMENT | { QR Code} | 01450999], and one red [ HOLOTYPE ♂ | Milanion | laricus Grishin ] GoogleMaps . Paratypes: 3♂♂ from Ecuador: 1♂ NVG-18018H08, USNMENT_01465135 the same data as the holotype but collected on 7-Nov-1992 GoogleMaps ; 1♂ NVG-15094B03, Napo, Yasuni Research Station, Rios Tivacuno and Tiputini , 250 m, GPS −0.633, −76.600, 22-Oct-1998, J. D. Turner leg. [ MGCL] GoogleMaps ; 1♂ NVG-18018H06, USNMENT_01450998 Sucumbios, Cerro Lumbaqui Norte , 800-950 m, GPS 0.028333, −77.320333, 18-22-Aug-2002, J. P. W. Hall and M. A. Solis leg. [ USNM] GoogleMaps .
Type locality. Ecuador: Napo Province, Jatun Sacha Biological Reserve, elevation 450 m, GPS −1.0667, −77.6167.
Etymology. The name alaricus is derived from Alarīks (king of all) with the prefix “alla-” (all, everybody, entire) suggests a kingly, royal, or noble identity. Laricus (i.e., not alaricus ) is a noun in apposition and a shorter name for this more northern species.
Distribution. Known only from northeastern Ecuador.
| USNM |
Smithsonian Institution, National Museum of Natural History |
| V |
Royal British Columbia Museum - Herbarium |
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
|
Kingdom |
|
|
Phylum |
|
|
Class |
|
|
Order |
|
|
Family |
|
|
Genus |
