Milanion ( Milanion ) furvus Grishin, 2023
|
publication ID |
https://doi.org/10.5281/zenodo.10396362 |
|
DOI |
https://doi.org/10.5281/zenodo.10622007 |
|
persistent identifier |
https://treatment.plazi.org/id/03810139-FFC8-BB47-C0CA-FEE9E004B412 |
|
treatment provided by |
Felipe |
|
scientific name |
Milanion ( Milanion ) furvus Grishin |
| status |
sp. nov. |
Milanion ( Milanion) furvus Grishin , new species
https://zoobank.org/ 371AD2A6-502E-44AF-B185-91A95AC388CE
( Fig. 2 part, 43–44, 256–257)
Definition and diagnosis. Several specimens from Panama identified as Milanion marciana Godman and Salvin, 1895 ( type locality in Panama) are in a clade different from M. marciana and Milanion latior Mabille and Boullet, 1917 ( type locality in Colombia) and are genetically differentiated from all other species in the genus ( Fig. 2). Therefore, they represent a new species. This new species does not key correctly to any species, including M. marciana (E.46.5), in Evans (1953) and differs from its relatives by a combination of the following characters: white spot in forewing cell CuA 2 -1A+2A is small, located by the vein 1A+2A and does not reach the middle of the cell, white patch on hindwing is broader than brown border, ventral hindwing with wide brown area by costa, cell Sc+R 1 -RS brown with a (usually) small white spot in the middle joined with the white central area with veins darker by the dark border. This species is not cryptic and is diagnosed reliably by phenotype. In DNA, a combination of the following base pairs is diagnostic in the nuclear genome: aly 2027.2.5:C51T, aly971.9.9:G51T, aly 2811.4.1:G248A, aly 2811.4.1:C249T, aly 1475.2.1:G48A, and COI barcode: T133G, T157C, T358C, T514C, A607C.
Barcode sequence of the holotype. Sample NVG-18018H04, GenBank OR837641, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAGTAGGAACCTCTTTAAGTTTATTAATTCGAACTGAATTAGGAAACCCAGGATCTTTAATT GGAGATGATCAAATTTATAATACTATTGTAACTGCGCATGCATTTATTATAATTTTTTTCATGGTCATACCAATTATAATTGGTGGATTTGGAAATT GATTAGTACCTTTAATATTAGGAGCCCCAGATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGATTATTACCCCCATCTCTTATATTATTAAT TTCAAGAAGTATTGTAGAAAATGGAGCAGGAACTGGATGAACAGTTTACCCACCTCTTTCAGCTAACATTGCCCATCAAGGCTCATCAGTAGATTTA GCAATTTTTTCTTTACATTTAGCTGGAATTTCTTCAATTTTAGGAGCTATTAATTTTATTACTACTATTATTAACATACGAGTAAATAATTTATCAT TTGATCAAATACCTTTATTTGTATGAGCCGTAGGTATTACAGCTTTACTTTTATTATTATCTTTACCTGTATTAGCAGGTGCTATTACTATATTATT AACTGACCGAAATTTAAACACATCCTTCTTTGACCCAGCAGGAGGAGGAGATCCAATTTTATACCAACATTTATTT
Type material. Holotype: ♂ deposited in the National Museum of Natural History , Smithsonian Institution, Washington, DC, USA ( USNM), illustrated in Fig. 43–44, bears the following four rectangular labels, three white: [ PANAMA: Panama | Farfan (C.Z.) | 8° 56′N, 79° 34′W | 6 Jan ‘72 | leg. S. S. Nicolay], [DNA sample ID: | NVG-18018H04 | c/o Nick V. Grishin], [USNMENT | { QR Code} | 01450996], and one red [ HOLOTYPE ♂ | Milanion | furvus Grishin ] GoogleMaps . Paratypes: 4♂♂ from Panama: Panama Province: 1♂ 11-BOA-13382E11 Panama City, Albrook Hotel and Area , 1–4-Aug-2007, R. H. Leuschner leg. [ USNM] ; 1♂ NVG-18018H03 Bayano , 23-Nov-1974, G. B. Small leg. [ USNM] ; 1♂ NVG-20053H02 Gamboa, Pipeline Road, 75 m, 9.127167, −79.714833, 2-Jun-2012, John R. MacDonald leg. [ MEM] GoogleMaps ; 1♂ NVG-20053H03 Veracruz, ca. 50 m, GPS 8.911833, −79.565722, 2-Jul-2013, John R. MacDonald leg. [ MEM] GoogleMaps .
Type locality. Panama: Panama Province, Farfan, GPS 8.933, −79.567.
Etymology. In Latin, furvus means dark, dusky, gloomy, or swarthy. The name, a masculine adjective, is given partly for the smaller white area and very small white spot in cell 7 on the ventral hindwing.
Distribution. Currently known only from central Panama.
| USNM |
Smithsonian Institution, National Museum of Natural History |
| V |
Royal British Columbia Museum - Herbarium |
| R |
Departamento de Geologia, Universidad de Chile |
| MEM |
University of Memphis |
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
|
Kingdom |
|
|
Phylum |
|
|
Class |
|
|
Order |
|
|
Family |
|
|
Genus |
