Pheraeus pulcher Grishin, 2023
|
publication ID |
https://doi.org/10.5281/zenodo.10396362 |
|
DOI |
https://doi.org/10.5281/zenodo.10622121 |
|
persistent identifier |
https://treatment.plazi.org/id/03810139-FF95-BB1B-C0CA-F924E74CB6E3 |
|
treatment provided by |
Felipe |
|
scientific name |
Pheraeus pulcher Grishin |
| status |
sp. nov. |
Pheraeus pulcher Grishin , new species
https://zoobank.org/ 309A87AC-194F-4AC8-BA2A-4E489BA69D46
( Fig. 7 part, 179–180, 413–414)
Definition and diagnosis. Phylogenetic trees reveal that specimens from Ecuador and Peru that look superficially similar to Pheraeus honta Evans, 1955 (type locality in Peru) are not monophyletic with it and show prominent genetic differentiation from it ( Fig. 7): e.g., their COI barcodes differ by 5.5% (36 bp), and therefore represent a new species. This new species is a distant sister to Pheraeus perpulcher (Hayward, 1934) (type locality in Argentina), while not being very similar to it in ventral wing patterns and differs by 6.1% (40 bp) in the COI barcode. This new species keys (incompletely and as the best overall compromise) to P. honta (L.11.1.) in Evans (1955) but has an orange tinted with brown at the tip tuft of long scales near the inner hindwing margin above. The holotype was misidentified as Pheraeus rumba Evans, 1955 (type locality in Brazil) but differs from it by the lack of yellow and hyaline spots in forewing cells M 1 -M 2 and M 2 -M 3 and the lack of submarginal brown “shading” of ventral hindwing postmedian spots: these white spots are encircled by relatively well-defined blackish frames and the submarginal area is of orange-yellow ground color, similar to P. honta . This species is not cryptic and is diagnosed reliably by phenotype. In DNA, a combination of the following base pairs is diagnostic in the nuclear genome: aly536.17.10:C39T, aly166.5.1:C267T, aly166.5.1:G282A, aly594.8.2:G80C, aly 1454.4.1:A246G, and COI barcode: T38C, A100G, T121C, C220A, T548C.
Barcode sequence of the holotype. Sample NVG-19016E11, GenBank OR837704, 658 base pairs: AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATACTAGGAACTTCATTAAGTTTATTAATTCGAACTGAATTAGGAAACCCAGGTTCTTTAATT GGGGATGATCAAATTTATAATACCATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATCGGAGGATTTGGTAATT GATTAGTTCCTCTTATATTAGGTGCACCTGATATAGCTTTCCCACGAATAAATAATATAAGATTTTGAATATTACCTCCTTCTTTAATATTATTAAT CTCAAGAAGAATTGTTGAAAATGGTGCAGGAACTGGATGAACAGTTTACCCTCCTTTATCTTCTAATATTGCCCATCAAGGTTCTTCAGTTGATTTA GCAATTTTTTCTTTACATTTAGCAGGAATTTCATCAATTTTAGGAGCTATCAATTTTATTACAACAATTATTAATATACGAGTTAAAAACTTATCTT TTGATCAAATACCTTTATTTGTATGATCTGTAGGTATTACAGCATTACTATTACTTCTATCTCTACCTGTTTTAGCAGGAGCTATTACTATACTTCT TACTGATCGAAATTTAAATACTTCATTTTTTGATCCAGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT
Type material. Holotype: ♂ currently deposited in the National Museum of Natural History, Smithsonian Institution , Washington, DC, USA ( USNM), illustrated in Fig. 179–180, bears the following five rectangular labels, four white: [ PERU Madre De Dios | Rio La Torre 300m | Tambopata Res. | 27 Sept. ‘89 | S. S. Nicolay], [ Pheraeus | rumba ♂ | Det. | S.S. Nicolay], [DNA sample ID: | NVG-19016E11 | c/o Nick V. Grishin], [USNMENT | { QR Code} | 01532334], and one red [ HOLOTYPE ♂ | Pheraeus | pulcher Grishin ] . Paratype: 1♀ Ecuador: Napo Province, Jatun Sacha Biological Reserve, elevation 450 m, GPS −1.0667, −77.6167, 7-Nov-1992, S. S. Nicolay leg. [ USNM].
Type locality. Peru: Madre de Dios, Tambopata National Reserve, Rio La Torre, elevation 300 m.
Etymology. In Latin, perpulcher means very beautiful. Even after removing the prefix “per”, we still have a beautiful species. A shorter name signifies a more northern distribution of this species. The name is a noun in apposition.
Distribution. The upper Amazonian region, known from Ecuador and Peru.
| USNM |
Smithsonian Institution, National Museum of Natural History |
| V |
Royal British Columbia Museum - Herbarium |
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
