Falga athena Grishin, 2023
|
publication ID |
https://doi.org/10.5281/zenodo.10396362 |
|
persistent identifier |
https://treatment.plazi.org/id/03810139-FF90-BB1F-C0CA-FDD0E73BB4F2 |
|
treatment provided by |
Felipe |
|
scientific name |
Falga athena Grishin |
| status |
sp. nov. |
Falga athena Grishin , new species
https://zoobank.org/ E9BA59DB-2467-42BA-9C5F-BEB41F8CF500
( Fig. 7 part, 191–192, 427–429)
Definition and diagnosis. Phylogenetic trees reveal that a specimen from Panama resembling a darker Falga sciras Godman, 1901 ( type locality in Honduras) is not monophyletic with it and shows prominent genetic differentiation from it ( Fig. 7): e.g., their COI barcodes differ by 5.9% (39 bp). This specimen also differs from all other species of Falga Mabille, 1898 ( type species Carystus jeconia Butler, 1870 ) and, therefore, represents a new species. This new species (incompletely) keys to Falga jeconia jeconia (I.1.2(b)) in Evans (1955). It differs from F. sciras by lacking a discal brown spot at the end of discal cell on the ventral hindwing and orange spots on the dorsal forewing not reaching the wing base. It differs from other species by orange, rather than yellow or yellow-orange spots and patches on the dorsal side and brown around the tornus on the ventral hindwing. This species is not cryptic and is diagnosed reliably by phenotype. In DNA, a combination of the following base pairs is diagnostic in the nuclear genome:aly 2423.6.2:G57A,aly1838.37.5:T96C, aly666.26.4:A100C,aly542.3.12:C99T, aly 1651.8.4:A153T, aly2548.20.5:C27C (not T), aly725.21.1:A114A (not G), aly208.47.15:T281T (not C), aly7689.2.1:T36T (not C), aly11945.4.1:T2088T (not C), and COI barcode: T250C, T352C, T355A, T530C, A565T.
Barcode sequence of the holotype. Sample NVG-18012E08, GenBank OR837710, 658 base pairs: AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACTTCTTTAAGTATATTAATTCGTACTGAATTAGGAAATCCAGGATTTTTAATT GGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATT GATTAGTTCCATTAATATTAGGAGCTCCTGATATAGCTTTTCCTCGAATAAATAACATAAGATTTTGAATATTGCCTCCTTCCCTAACATTATTAAT TTCAAGAAGAATTGTTGAAAATGGTGCAGGAACTGGATGAACAGTTTATCCCCCTCTTTCCTCAAATATTGCTCATCAAGGATCTTCTGTTGATTTA GCAATTTTTTCTCTTCATTTAGCTGGAATTTCTTCTATTCTTGGAGCTATTAACTTTATTACTACAATTATTAATATACGAATTAAAAATAGATCAT TTGATCAAATACCATTATTTGTATGATCTGTGGGAATTACAGCACTTTTATTACTTTTATCTTTACCTGTATTAGCAGGTGCTATTACTATACTTCT TACAGATCGAAATCTTAATACATCTTTTTTTGATCCTGCAGGAGGAGGGGATCCAATTTTATATCAACATTTATTT
Type material. Holotype: ♀ deposited in the National Museum of Natural History , Smithsonian Institution,
Washington, DC, USA ( USNM), illustrated in Fig. 191–192, bears the following four rectangular labels, three white: [ PANAMA: Darien | Cana 1550m | 23.III.1983 | leg. G.B.Small], [DNA sample ID: | NVG-18012E08 | c/o
Nick V. Grishin], [USNMENT | {QR Code} | 01450279], and one red [ HOLOTYPE ♀ | Falga athena | Grishin]. Type locality. Panama: Darien Province, Cana, elevation 1550 m.
Etymology. Sciras is the surname of Athena, an Olympian goddess. The name athena signifies that the new species is closest in wing pattern to F. sciras . The name is a noun in apposition.
Distribution. Currently known only from the holotype collected in eastern Panama.
| USNM |
Smithsonian Institution, National Museum of Natural History |
| V |
Royal British Columbia Museum - Herbarium |
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
|
Kingdom |
|
|
Phylum |
|
|
Class |
|
|
Order |
|
|
Family |
|
|
Genus |
