identifier	taxonID	type	CVterm	format	language	title	description	additionalInformationURL	UsageTerms	rights	Owner	contributor	creator	bibliographicCitation
03C75B5FFFE8D75BFF01DDA3FAE1F9FF.text	03C75B5FFFE8D75BFF01DDA3FAE1F9FF.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Megaschizomus Lawrence 1969	<div><p>Megaschizomus Lawrence, 1969</p><p>Type species. Megaschizomus mossambicus (Lawrence, 1958) from Mozambique.</p><p>Diagnosis. Megaschizomus can be recognized by: 1) the presence of a row of eight to nine setae on anterior margin of propeltidium; 2) the absence of coronate eyes or eye-spots; 3) the presence of two sub-marginal rows of small setae on abdominal tergites II–VII; 4) female flagellum with five annuli and six flagellomeres, the two posterior annuli wider than the rest, male flagellum without annuli; 5) fixed finger of chelicera with three teeth, one large tooth between the two main teeth; 6) movable finger of chelicera with one guard tooth and six or seven accessory teeth; 7) segment XII without posterodorsal process in male; 8) the presence of one pair of spermathecal lobes and absence of chitinized arch; 9) leg IV femur anterodorsal margin produced an angle of less than 90°.</p></div>	https://treatment.plazi.org/id/03C75B5FFFE8D75BFF01DDA3FAE1F9FF	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		MagnoliaPress via Plazi	Zheng, Tao;Wu, Keliang;Zhang, Feng	Zheng, Tao, Wu, Keliang, Zhang, Feng (2025): First record of the subfamily Megaschizominae Rowland, 1973 from China, with description of a new species of Megaschizomus Lawrence, 1969 (Schizomida: Hubbardiidae). Zootaxa 5661 (1): 80-94, DOI: 10.11646/zootaxa.5661.1.3, URL: https://doi.org/10.11646/zootaxa.5661.1.3
03C75B5FFFE8D756FF01DFF3FEA0FEB3.text	03C75B5FFFE8D756FF01DFF3FEA0FEB3.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Megaschizomus zhongshanensis Zheng & Wu & Zhang 2025	<div><p>Megaschizomus zhongshanensis sp. nov.</p><p>Figs 1–16, Table 1</p><p>中Ɯ巨&amp;</p><p>Type material. Holotype ♂ (MHBU-ZT- 6-1), CHINA: Guangdong Province, Zhongshan City, Zhongshan National Forest Park, 22.4898°N, 113.3701°E, 256 m elev., 10 June 2024, leg. Keliang Wu (fig. 1).</p><p>Paratype: 1♀ (MHBU-ZT-6-2), same data as the holotype .</p><p>Etymology. The specific name is a noun in apposition, referring to the name of the type locality.</p><p>Diagnosis. The new species is assigned to the genus Megaschizomus based on the following characters: 1) anterior margin of propeltidium: male with a row of eight setae and female with one row of nine setae(fig. 6A–B); 2) eye spots or coronate eyes absent; (fig. 5A, C) 3) abdominal tergites II–VII with two rows of setae (fig. 7A–B); 4) flagellum with five annuli separating six flagellomeres (fig. 12D–F); 5) fixed finger of chelicera with one large tooth between the two main teeth (fig. 9A–D); 6) movable finger of chelicera with one guard tooth and six or seven accessory teeth (fig. 9B, D); 7) segment XII without posterodorsal process in male (fig. 12C); 8) female genitalia with one pair of spermathecal lobes and absence of chitinized arch (fig. 15A–D); 9) leg IV femur anterodorsal margin produced an angle of less than 90° (fig. 11A–B).</p><p>This new species can be distinguished from other two Megaschizomus species by: the propeltidium covered with numerous setae distributed in V-shaped pattern (Figs 5A, C, 6A–B); the distinctly divided metapeltidium, with two pairs microsetae (arrows in Figs 5A, C, 6A–B); by the presence of three smooth G6 setae in the chelicera, and proximal tooth of fixed finger with one tiny, blunt lateral tooth (Figs 8A–D, 9A–D); and the flagellum of male nearly spoon in shape from dorsal view (Figs 12A, 13A). This new species resembles Megaschizomus mossambicus (Lawrence, 1958) in having duct openings on the lobes of spermathecae and having two sclerotized plates behind the lobes (Reddell &amp; Cokendolpher, 1984: figs 1–2), but can be distinguished by: 1) the longer, more or less arcuately curved lobes of spermathecae and the bell-shaped plates (Figs 15A–D) vs. the short, not curved lobes of spermathecae and the round-shaped plates (Reddell &amp; Cokendolpher, 1984: fig. 2); 2) the absence of spine on tibia of pedipalps (Figs 10A–F) vs. having five spines on inner ventral margin (Lawrence, 1958: fig. 4g).</p><p>Description. Holotype Male (Figs 3A, B, 4A, B): measurements as in Table 1. Color (in 75% alcohol): brownish. Prosoma (Figs 5A, B, 6A): anterior margin of propeltidium with a row of eight setae, the propeltidium covered with numerous setae distributed in V-shaped pattern (Fig. 6A); eye spots or coronate eyes absent. Metapeltidium divided distinctly, with two pairs microsetae (Fig. 6A). Anterior sternum with 19 setae; posterior sternum triangular with nine setae.</p><p>Chelicerae (Figs 8A, B, 9A, B): movable finger: serrula with 27 teeth, guard tooth present, with six small accessory teeth at middle part of movable finger. Fixed finger with only one large tooth between the two main teeth, and proximal tooth with one tiny, blunt lateral tooth. Setation: setal group formula: 3–5–9–0–19–12–3–8. G1 with one spatulate setae; G2 composed of five smooth setae; G3 with nine setae, feathered apically and smooth basally; G4 absent; G5A with 19 similarly sized setae, feathered apically and smooth basally, length almost equal to movable finger; G5B with 12 feathered setae; G6 with three smooth setae about 1/2 of movable finger length; G7 with eight smooth setae.</p><p>Pedipalps (Figs 10A, B, E): 2.51 times longer than propeltidium; trochanter with apical process, acuminate apical process with angle of about 60°; mesal surface of trochanter with 17 setae near ventral margin and eight setae near dorsal margin; with one small mesal spur; ventral margin on ectal surface with two rows of small setae. Femur 1.96 times longer than high; ventral margin on ectal surface with acuminate setae Fe1–5, Fev1, Fev2, dorsal setae Fed1–3 and three rows of microsetae; mesal surface with Fm 1–8, a row of ventral setae Fmv1–6 and three dorsal setae Fmd1–3. Patella with six acuminate setae Pe1–6 and one seta Pme1 on ventro-ectal surface; with five feathered setae Pm1–5 and setae Pmm2–3 on ventro-mesal surface. Setae formula on tibia 6–6–5 (Ter–Tmr–Tir), Ter acuminate, Tmr and Tir feathered; medial- ventral of tibia with a feathered Tm. Tarsal spurs asymmetrical, as long as a third for the length of tarsal claw; tarsal claw sharp and curved.</p><p>Legs: leg I, basitarsal–telotarsal proportions: 74: 31: 17: 16: 17: 18: 40. Femur IV 3.95 times longer than high, with anterodorsal margin produced an angle of less than 90° (Fig. 11A).</p><p>Opisthosoma: tergite I with two pairs of microsetae anteriorly and one pair of posterior macrosetae; tergite II with three pairs of microsetae anteriorly and four pairs of posterior macrosetae (Fig. 7A); tergites III–VIII with two rows of setae each; tergite IX with pairs Dm, Dl1, Dl2 and two pairs of anterior setae. Segments X–XII telescoped, with setal pairs Dm, Dl1, Dl2 and a row of ventral seate each; segment XII without posterodorsal process. Sternite II with a row of setae. Sternites III–VIII with three irregular rows of setae each; genital plate with scattered setae.</p><p>Flagellum (Figs 12A–C, 13A–C): nearly spoon in shape from dorsal view; 2.31 times longer than wide; with median elevated ridge, apex of ridge extends horizontally, forming two near semi-elliptical transparent plates, Vshaped depression in front of ridge; ventral view shows depression towards center. Setation Dm1, Dm3, Dm4; Dl1, Dl2, Dl3; Vm1, Vm2, Vm3, Vm4, Vm5; Vl1, Vl2 and an unknown seta. Seta Dm1 at same level as Vm3; Dl1 at same level as Vm2; Vm1 anterior to Vm2; unknown seta anterior to Dl2; Vm4 posterior to Dm3; Vl1 anterior to Dm4; Vm5 at same level as Vl2; Dl3 posterior to Vl2; two Msp between Dl3 and Vm3.</p><p>Male genitalia (Figs 14A, 16A–D). Gonosternite (opisthosomal sternite I+II) large, occupying approximately third of the opisthosomal length, entirely covered with microsetae (Fig. 14A); posterior half with a pair of curved dark stripes, (Pterapophysis: Pt). Internal male genitalia framed in a furcula (Fu), which has a pair of flattened longitudinal and thick lateral bars (LBFu), these bars bifurcate posteriorly and form the ventral (VAFu) and the dorsal arms (DAFu). Pt distal end curves inward and longer than the median septum (MS). The folds of the gonopod (FGp) are positioned anterior to the Bridge (Br). LBFu has one pair of Ar on inner side, Ar almost as thick as LBFu. The arch (Ar) located beside inner side of LBFu, Ar almost as thick as LBFu (Figs 15A–D).</p><p>Female. Paratype (Figs 3C, D, 4C, D): measurements as in Table 1. Color (in 75% alcohol): brownish. Pedipalps (Figs 10C, D, F) similar to male, 2.69 times longer than propeltidium, setae formula on tibia 6–6–6. Prosoma (Figs 5C, D, 6B): anterior margin of propeltidium with a row of nine setae. Opisthosoma: tergite II with six pairs of posterior macrosetae (Fig. 7B). Flagellum (Figs 12D–F, 13D–F) with five annuli separating six flagellomeres, setation Dm1, Dm3, Dm4; Dl1, Dl2, Dl3, Dl4; Vm1, Vm2, Vm3, Vm4, Vm5; Vl1, Vl2 and an unknown seta. Seta Dm1 at same level as Vm2; Dl1 at same level as Vm3; Vm1 anterior to Dm1; unknown seta at same level as Dl2; Dm3 at same level as Dm2; Vm4 at same level as Vl1; Vl1 anterior to Dm4; Vm5 at same level as Dl4; Dl3 posterior to Vl2. Spermathecae (Figs 14B, 15A–D) with with one pair of long, tubular lobes not increasing in diameter apically; lobes curved approximately arcuate, with DO; with two sclerotized bell-shaped plates behind the lobes; chitinized arch and gonopod absent. Chelicerae (Figs 8C, D, 9C, D): movable finger with six prominent accessory teeth; serrula with 27 teeth. Setal group formula 3–5–7–0–17–15–3–12.</p><p>Natural history. The new species were collected at night from a relatively moist area filled with leaf litter and small stones next to a stream in the forest park (Figs 2A, B, Figs 3A–D). One male and one female (holotype and paratype respectively) were captured together.</p><p>Distribution. This species is known only from the type locality (Fig. 1).</p><p>DNA barcode (COI).</p><p>TAAAGATATTGGAACAATATATATAATTTTTGGATTATGAGCATCTATATTAGG G G G G G C TATA A G A C T T T TA AT C CG A A C A G A A C TA G G T T C G T G T G G TA G T T TTTTAGGTAGTGATCAACTCTATAATGTTATTGTTACTTCCCATGCTTTTGTAAT A ATT TTTT TTATA GT TATACCA ATTATAAT TG GGG GAT TTG GTA ATCTAT TACT T CCAT T GATAAT TG GCG CACCTG ATATAG CTT TTCCA CGA CTTA ATA ATT TAA G ATT TTG ACT TCTTAT T CCAT CA CTCTTAT TT CTTAT CTTAT CG AGAT T TATCC A A CTA GG T TCA G GA A CT GG TT G AA CT GTATAC CCTC CTCTAT CTA G TATTAC A GC ACAT GCA G GA G CTG CT GTAG AT T TTA CA AT CT TT TCT CT TCATT TA G CG G GAG CAA GAT CTATT CTAG CCT CAAT TAAT TT TATTA CAA CA AT CAT TA ACAT A CGATCT TCA A CAATA ACA CTT GA A CGA CTA CCCCT TTT TG TT TG AT CA AT C T T A AT T A C A A C T AT T T T AT T G T T A AT T G C T C T A C C C G T T C T T G C A G G A G C T AT T A C T AT A C T T C T AT T A G AT C G A A AT T T T A AT A C T T C AT T C T T T G AT C C T T C T G G G GGAGGAGATCCTATTCTCTACCAACATTTATTTTGATTTTTTGGTCAC (GenBank accession number: PV461568).</p></div>	https://treatment.plazi.org/id/03C75B5FFFE8D756FF01DFF3FEA0FEB3	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		MagnoliaPress via Plazi	Zheng, Tao;Wu, Keliang;Zhang, Feng	Zheng, Tao, Wu, Keliang, Zhang, Feng (2025): First record of the subfamily Megaschizominae Rowland, 1973 from China, with description of a new species of Megaschizomus Lawrence, 1969 (Schizomida: Hubbardiidae). Zootaxa 5661 (1): 80-94, DOI: 10.11646/zootaxa.5661.1.3, URL: https://doi.org/10.11646/zootaxa.5661.1.3
