taxonID	type	description	language	source
03C0BA2C20643D153BD3CF95FE25FE18.taxon	description	(Figs. 1 – 19)	en	Cava, Sara La, Rijllo, Giuseppe, Zucco, Giada, Scalercio, Stefano (2025): Revisiting the genus Diplodoma Zeller, 1852 in Europe: DNA barcoding reveals the presence of an undescribed species from forested habitats of southern Italy (Lepidoptera: Psychidae). Zootaxa 5583 (2): 371-382, DOI: 10.11646/zootaxa.5583.2.8, URL: https://doi.org/10.11646/zootaxa.5583.2.8
03C0BA2C20643D153BD3CF95FE25FE18.taxon	materials_examined	Type material. Holotype. [ITALIA] ♂, CALABRIA, — CC _ C 2, V. ne Argentino, Montalto Uff., 565 m — 1. VI. 2016, 39.4082 °, 16.1209 °, Scalercio & Infusino leg. [DNA barcode specimen ID LEP-SS- 04527]. Paratypes. [ITALIA] 1 ♂, CALABRIA SL _ AF, Vallone Tasso, Spezzano Sila (CS), 1402 m — 9. VII. 2018, 39.332823 °, 16.414273 °, Scalercio S. leg. [DNA barcode specimen ID LEP-SS- 04552]; Gen. prep. CREA — 0279, Stefano Scalercio; 1 ♂, ITALIA — CALABRIA SL _ AM, Vallone Tasso, Spezzano Sila (CS), 1376 m — 16. VII. 2018, 39.332393 °, 16.418499 °, Scalercio S. leg. [DNA barcode specimen ID LEP-SS- 04553], Gen. prep. CREA — 0266, Stefano Scalercio.	en	Cava, Sara La, Rijllo, Giuseppe, Zucco, Giada, Scalercio, Stefano (2025): Revisiting the genus Diplodoma Zeller, 1852 in Europe: DNA barcoding reveals the presence of an undescribed species from forested habitats of southern Italy (Lepidoptera: Psychidae). Zootaxa 5583 (2): 371-382, DOI: 10.11646/zootaxa.5583.2.8, URL: https://doi.org/10.11646/zootaxa.5583.2.8
03C0BA2C20643D153BD3CF95FE25FE18.taxon	diagnosis	Diagnosis. Male antenna composed by about 35 antennomers as in D. taurica, while in D. laichartingella is composed by no more than 30 antennomers. Intercalary cell presents as in D. laichartingella, lacking in D. taurica. In male genitalia (Figs. 5, 10) the length-to-width ratio (L-W ratio) of clasper is significantly higher in D. giulioregenii (N = 2; L-W ratio ranging from 1.8 to 2.5) than in available dissected males of D. laichartingella (N = 9; L-W ratio min = 0.7; mean = 1.0 ± 0.2; max = 1.3) (Figs. 11 – 17) and is similar to the picture of the original description of D. taurica (LW ratio = 1.9). Tendon 35 degrees angled upward at about half of its length in D. giulioregenii (Fig. 18 a), straight in D. taurica, (Fig. 18 b) and mild curved upward in D. laichartingella (Fig. 18 c). Despite the worn appearance of types, D. giulioregenii does not seem to be significantly different from D. laichartingella in terms of wing pattern and wingspan, whereas D. taurica is significantly smaller (Arnscheid & Weidlich, 2017). Descriptions External characters (Figs. 1 – 4). Adult male, holotype (Fig. 1): wingspan 12 mm; colouration and vestiture: head (Fig. 2) covered in light-brown, shiny, short hairs on frons, with longer light-brown hairs posterior to antennal sockets; labial palpi (Fig. 3, left side (a) and top view (b )) elongated and densely covered with long scales. Round compound eye about 320 µm heigh; distance between eyes about 450 µm; a well-developed ocellus present immediately above. The antenna (Fig. 4) thread-like, approximately half-length of the costa, composed by about 35 – 38 antennomers; dorsally covered by scales and ventrally ciliated with cilia in average 115 µm long. The thorax is covered with shiny light-brown hairs. The forewings are elongated and darkish, with shiny light spots that are visible on coastal margin and with shiny yellowish scales visible in the inner margin. Cloaking scales of forewings belong to IV class (Sauter, 1956). The fringe scales are short and compact, with shiny light spots. Venation with 10 veins from discal cell; intercalary and accessory cells present. The hindwings are uniformly brownish, with a few shiny light spots on the proximal margin of the wings. Venation with 6 veins from discal cell. The fringe scales are longer near the proximal margin of the hindwings and shorter toward the distal margin. Adult female. unknown. Male genitalia (Figs. 5 – 9). Valva short and distinctly sclerotized, narrower distally with rounded apex, densely covered with short hairs (Fig. 5). The tendon is short and angled upward by 35 degrees at half of its ventral length. Sacculus long about two-thirds of valva length, roundish caudally with clasper narrower distally, distinctly pointed, and sclerotized. Vinculum and tegumen fused. Pointed saccus 295 µm long and 56 µm wide at half of its length (Fig. 6). Slightly oval tegumen, distally with two hump shaped appendages (Fig. 7). Phallus 708 µm long, thin slightly curved and broader caudally (Fig. 8), bearing distally 4 tooths that become smaller proximally (Fig. 9). Case. unknown. Variation. we cannot observe variation in wings pattern because our specimens are worn due to the collecting method. The only observable variation is in wingspan, which ranges between 12 mm and 13 mm (n = 3) (Fig. 1, 19), and in phallus length ranging 684 and 708 µm in paratypes. Genetic data. the maximum intra-BIN difference is 0.8 % with the two paratype identical to each other. The intra-BIN average distance is 0.54 % (n = 3). The distance from the nearest BIN (BOLD: AAF 5091) is 6.25 %, and it is composed by European sequences of Diplodoma laichartingella. The p-distance from the Nearest Member calculated by the BOLD Identification System is 6.76 % for the holotype and 6.45 % for the paratypes. The Nearest Member is a specimen from Norway (Sample ID: NHMO-DAR- 12513). In the neighbor-joining tree (Fig. 20) resulting from the analyses of available DNA barcoding sequences belonging to the genus Diplodoma, eight distinct BINs were present across the European continent and one in Far East Asia. Phylogenetic analysis showed that the cluster of Diplodoma giulioregenii separates earlier than the branches containing D. laichartingella and D. adspersella. Diagnostic SNPs. we report the 679 bp long DNA barcoding sequence of the holotype compared with the Diplodoma sequences utilised in this paper, with the 23 diagnostic SNPs (Single Nucleotide Polymorphism) evidenced in bold: TTTATATTTTATTTTAGG T ATTTGA T C G GGAATAATTGGAACATCTTTAAGATT A TTAATTCGAGTAGAAT TAGG G ATTCCTAATTCATTTCTTGGAAGAGATCAAATTTATAATACTATTGTAAC T GCTCATGCCCTTATT ATAATTTTTTTTATAGTTATACCTATTATAATTGG G GGATTTGGAAATTGATTAGTACCTTTAATATTGGGG GCCCCTGATATAGCTTTCCCTCGTATAAATAATATAAGATTTTGACTTCTTCC A CCTTCTTTAATAATTTT AATTATAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAAC A ATTTA T CCTCC CC T T TCTTCTA ATTTAACCCATTCAGGAAGTTCAGTTGATTTAGCAATTTTTTCTTTACATTTAGCAGGAATTTCATCTAT TTTAGGGGCAGTAAATTTTATTACAACAATTATTAATATACGACCATTTAA C ATATC A TTAGATCAAATAC C C TTATTTGTATG G TCTGTGGCTATTACTGCAGTA C T T TTACTTTTATCTTTACCAGTTTTAGCTGGAGC AATTACTATGTTATTAAC C GATCGAAATTTAAATACATC G TTTTTTGATCCTGCTGGAGGTGGAGA C CCT ATTTTATTCCAACATTTATTTTGATTTTTTGGTCACCCTGAAGTT. Biology: unknown. Distribution: endemic of South Italy, with type specimens collected from two different mountainous areas, the Catena Costiera Paolana and the Sila Massif, at a distance of 27 km. Habitat: all specimens were found in forested habitat, the holotype in a dense chestnut woodlot and the paratypes in a pure beech forest and in a mixed beech-Calabrian black pine forest. Derivatio nominis: in memory of a young Italian researcher murdered by all the evil in the world, waiting for the truth for Giulio Regeni.	en	Cava, Sara La, Rijllo, Giuseppe, Zucco, Giada, Scalercio, Stefano (2025): Revisiting the genus Diplodoma Zeller, 1852 in Europe: DNA barcoding reveals the presence of an undescribed species from forested habitats of southern Italy (Lepidoptera: Psychidae). Zootaxa 5583 (2): 371-382, DOI: 10.11646/zootaxa.5583.2.8, URL: https://doi.org/10.11646/zootaxa.5583.2.8
03C0BA2C20613D183BD3C8E2FD9DFF68.taxon	description	DNA barcoding analyses we carried out, highlighted a high COI diversification of Diplodoma laichartingella and D. adspersella without a clear separation between them. In the Neighbour-Joining tree of European Diplodoma (Fig. 20), D. adspersella and D. laichartingella present in BOLD and identified by the authors on the basis of morphology, are not coherently separated by barcoding. One Slovenian specimen, that refers to a larva and its case, was morphologically identified as D. adspersella and included in a BIN (BOLD: AAP 9669) together with Slovenian and Austrian D. laichartingella specimens identified using wing pattern. In other two cases the name D. adspersella has been attributed by wing patterns to all the specimens composing the BINs, but these BINs are intermixed with those of D. laichartingella, making a mtDNA-based differentiation of these taxa unlikely. In light of our genetic analyses, that further weaken the validity of D. adspersella questioned by several authors due to the lack of morphological differences, we propose Diplodoma adspersella Heinemann, 1870 as a junior synonym of Diplodoma laichartingella (Goeze, 1783).	en	Cava, Sara La, Rijllo, Giuseppe, Zucco, Giada, Scalercio, Stefano (2025): Revisiting the genus Diplodoma Zeller, 1852 in Europe: DNA barcoding reveals the presence of an undescribed species from forested habitats of southern Italy (Lepidoptera: Psychidae). Zootaxa 5583 (2): 371-382, DOI: 10.11646/zootaxa.5583.2.8, URL: https://doi.org/10.11646/zootaxa.5583.2.8
