identifier	taxonID	type	CVterm	format	language	title	description	additionalInformationURL	UsageTerms	rights	Owner	contributor	creator	bibliographicCitation
791099101D915C118A0546BAFB55238D.text	791099101D915C118A0546BAFB55238D.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Leptopilina australis (Belizin 1966)	<div><p>Leptopilina australis (Belizin, 1966)</p><p>Rhoptromeris australis Belizin, 1966: 87 .</p><p>Diagnosis.</p><p>Leptopilina australis is a relatively small species (1.3–1.4 mm ♀ body length in a small number of measured females) with somewhat slender appearance and a relatively short antenna (Fig. 2 A).</p><p>The species is unique in the combination of the mesoscutum having rows of setae mediolaterally (Fig. 11 A, susceptible to damage), a state shared with L. clavipes (mesoscutum glabrous in other species), and the short metapleural ridge 1 (Fig. 2 D, see Fig. 9 A for an overview on the metapleural ridges 1–3). The short ridge is shared with L. fimbriata, but in other species it is either absent ( L. boulardi) or at least half the length of the metapleuron.</p><p>The metapleural ridge 2 is shorter than half the length of the metapleuron, albeit longer than ridge 1 (Fig. 2 D). The ridge 2 is equally long in L. boulardi, L. clavipes and L. fimbriata but at least half the length of the metapleuron in the other species.</p><p>A setal patch on the base of the hind coxa is present (Fig. 2 D), in contrast to L. japonica and L. boulardi, where there are at most a few singular setae that are not arranged in a patch.</p><p>Biology.</p><p>Habitat. Occurs in parks and forests, mainly in nemoral deciduous forest, with decaying plant material and fungal fruiting bodies. In one study, the species emerged from Drosophila spp. developing in the petioles of Heracleum mantegazzianum Sommier &amp; Levier (giant hogweed). Additionally, it shows attraction to Phallus impudicus L. (common stinkhorn), but was never recovered from it in situ. Not attracted to fermenting fruit. Rarely collected in Malaise traps or by sweep netting.</p><p>Flight period. July to September.</p><p>Host. Mainly Drosophila limbata Roser, 1840 and other species within the Drosophila quinaria species group (van Alphen et al. 1991; Eijs and van Alphen 1999).</p><p>Ex situ reared from Drosophila kuntzei Duda, 1924 and Scaptomyza pallida (Zetterstedt, 1847), and to a lesser degree from Drosophila transversa Fallén, 1823 (van Alphen et al. 1991). Not reared from D. busckii Coquillett, 1901, D. immigrans Sturtevant, 1921, D. phalerata Meigen, 1830, D. subobscura Collin, 1936, and Lordiphosa fenestrarum Fallén, 1823, despite sharing the ecological niche with the suitable hosts (van Alphen et al. 1991).</p><p>Population parameters. Primarily thelytokous with occasional development of males, observed after ex situ diapause by van Alphen et al. (1991).</p><p>Distribution.</p><p>Western Palearctic but sparsely distributed, possibly spreading towards northwest but slowly and still uncommon. Armenia (locus typicus of Rhoptromeris australis), Belgium (new record), Denmark, the Netherlands and Slovenia.</p><p>Remarks.</p><p>Originally described in the genus Rhoptromeris Förster, 1869 but moved to Leptopilina Förster, 1869 by Nordlander and Grijpma (1991).</p><p>We did not successfully sequence any specimen of L. australis . At present, barcode sequence information is available neither on BOLD nor on DROP.</p></div>	https://treatment.plazi.org/id/791099101D915C118A0546BAFB55238D	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Vogel, Jonathan;Martin, Jakob;Forshage, Mattias;Salden, Tobias;Staverløkk, Arnstein;Verheyde, Fons;Nordlander, Göran;Herz, Annette;Peters, Ralph S.	Vogel, Jonathan, Martin, Jakob, Forshage, Mattias, Salden, Tobias, Staverløkk, Arnstein, Verheyde, Fons, Nordlander, Göran, Herz, Annette, Peters, Ralph S. (2025): The Leptopilina Förster, 1869 of the Western Palearctic, and an updated list of the world species (Hymenoptera, Figitidae, Eucoilinae). Journal of Hymenoptera Research 98: 915-969, DOI: 10.3897/jhr.98.165583
13E9BDC71FD05AC49EE3162B4F1ADE6D.text	13E9BDC71FD05AC49EE3162B4F1ADE6D.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Leptopilina boulardi (Barbotin, Carton & Kelner-Pillault 1979)	<div><p>Leptopilina boulardi (Barbotin, Carton &amp; Kelner-Pillault, 1979)</p><p>Charips mahensis Kieffer, 1911: 312 – secondary junior homonym in Leptopilina of Erisphagia mahensis Kieffer, 1911 .</p><p>Cothonaspis (Cothonaspis) boulardi Barbotin, Carton &amp; Kelner-Pillault, 1979: 20–26 .</p><p>Diagnosis.</p><p>Leptopilina boulardi is a small to medium-sized species (up to 1.5 mm ♀ body length) with a stout appearance and relatively short appendages (Fig. 3 A).</p><p>The species is unique by its smooth metapleuron, having at most a short ridge 2 and the other ridges absent (Fig. 3 D). In all other species, the three ridges are at least somewhat developed. Also, the propodeal carinae are diverging to a varying degree in the posterior half of the propodeum (Fig. 3 E). Other species have their propodeal carinae running uniformly straight or outwardly curved from the anterior to the posterior margin of the propodeum.</p><p>The sculpture on the dorsal surface of the mesoscutellum is striate. The striae are radiating from the base of the mesoscutellar plate (Fig. 3 C) and the posterior surface is areolate. The sculpture of L. heterotoma is similar, though the striae are more dispersed elong the entire length of the mesoscutellar plate and the posterior surface is foveate-reticulate. In other species, the mesoscutellum is sculptured entirely foveate-reticulate. Just as in L. japonica, the setal patch on the base of the metacoxa of L. boulardi is absent. There are at most a few singular setae (Fig. 3 D).</p><p>The forewing is usually relatively small with a narrow, elongate marginal cell, but can be different and is thereby not sufficient as a diagnostic character.</p><p>Biology.</p><p>Habitat. Occurs in forests and orchards.</p><p>Flight period. At least June to October, mainly July to August, in European data. Clearly able to breed around the year in warm climates, as it is present also in winter months in Macaronesia and North Africa. In data from the USA, there seems to be a distinct spring generation in May, also, there is a record from January in Florida.</p><p>Hosts. Specialist of fruit-inhabiting Drosophila; emerged from D. melanogaster and D. simulans Sturtevant, 1919 in fermenting fruits (Nordlander 1980; Vet and van Alphen 1985; van Alphen and Vet 1986; Fleury et al. 2009). Attacks D. suzukii, but is not able to develop in this host (Chabert et al. 2012) and is not suitable for application in biological control (Gonzalez-Cabrera et al. 2019).</p><p>Ex situ: Reared from D. virilis Sturtevant, 1916 and the non-Western Palearctic species D. erecta Tsacas &amp; Lachaise, 1974, D. eugracilis Bock &amp; Wheeler, 1972, D. mauritiana Tsacas &amp; David, 1974, D. pseudoobscura Frolova &amp; Astaurov, 1929, D. sechellia Tsacas &amp; Bächli, 1981, D. teissieri Tsacas, 1971; in some cases, with very high encapsulation rates (Schlenke et al. 2007).</p><p>Population parameters. Relative abundance in summer is parallel to D. simulans (Fleury et al. 2004; Mazzetto et al. 2016). French populations of L. boulardi were fully pro-ovigenic and developed at temperatures between 20–28 ° C ex situ (Moiroux et al. 2013). Thermal reaction and life history parameters are adapted to macrohabitat and less to geographic range, indicating an adaption to the habitat-specific host range (Moiroux et al. 2013). No Wolbachia Hertig, 1936 symbionts were detected in examined populations (Vavre et al. 2009; Wachi et al. 2015).</p><p>Distribution.</p><p>Cosmopolitan species; in Western Palearctic with a center in the Mediterranean region and not extending far north: found in the Canary Islands, France, Greece, Iran, Italy, Madeira, Portugal, Serbia, Spain, Switzerland, Tunisia and Turkey. Also present in the Afrotropics: Democratic Republic of the Congo, Republic of the Congo, Gambia, Ivory Coast, Kenya, Madagascar, Seychelles (locus typicus of Charips mahensis), South Africa, Zambia and Zimbabwe; in North America: Canada and USA (east and west); South America: Argentina, Brazil, Guadeloupe (locus typicus of Cothonaspis boulardi), and Mexico; and in Australia and Vanuatu. We have not seen records from tropical Asia, but the species is probably also present there.</p><p>Remarks.</p><p>Originally described as Charips mahensis Kieffer, 1911, the name became a secondary homonym with Erisphagia mahensis Kieffer, 1911 when both species were moved into Leptopilina by Nordlander (1980). The junior synonym name Leptopilina boulardi (Barbotin, Carton &amp; Kelner-Pillault, 1979) was available and became the valid name of this species, whereas it is the other species, originally Erisphagia mahensis Kieffer, 1911 which is now Leptopilina mahensis (Kieffer, 1911) .</p><p>The species was diagnosed and redescribed in Lue et al. (2016) and Nordlander (1980) describes and illustrates some of the morphological variation regarding the propodeal carinae in different L. boulardi strains.</p><p>We obtained specimens from a laboratory population late during the project and did not see the necessity to sequence the species ourselves because many records identified as L. boulardi by hymenopterist experts are already available in GenBank, BOLD and DROP and represent a singular BIN (BOLD: ACB 7933, note that one likely erroneously associated specimen image does not show a Leptopilina boulardi but an aculeate wasp, accessed 27 th June 2025). An unambigous identification of the species with CO 1 barcode data or morphology is comparably unproblematic. We neither included sequences from external sources into the dataset for the species delimitation, nor utilised them for the molecular characterisation of L. boulardi because we only included those sequences in the analyses which we could examine morphologically ourselves.</p></div>	https://treatment.plazi.org/id/13E9BDC71FD05AC49EE3162B4F1ADE6D	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Vogel, Jonathan;Martin, Jakob;Forshage, Mattias;Salden, Tobias;Staverløkk, Arnstein;Verheyde, Fons;Nordlander, Göran;Herz, Annette;Peters, Ralph S.	Vogel, Jonathan, Martin, Jakob, Forshage, Mattias, Salden, Tobias, Staverløkk, Arnstein, Verheyde, Fons, Nordlander, Göran, Herz, Annette, Peters, Ralph S. (2025): The Leptopilina Förster, 1869 of the Western Palearctic, and an updated list of the world species (Hymenoptera, Figitidae, Eucoilinae). Journal of Hymenoptera Research 98: 915-969, DOI: 10.3897/jhr.98.165583
2012FC72C15F5DE684CF89AB98F0A56E.text	2012FC72C15F5DE684CF89AB98F0A56E.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Leptopilina clavipes (Hartig 1841)	<div><p>Leptopilina clavipes (Hartig, 1841)</p><p>Cothonaspis clavipes Hartig, 1841: 357 .</p><p>Diagnosis.</p><p>Leptopilina clavipes is a size-variable species with relatively short appendages (Fig. 4 A).</p><p>The species has a unique mesoscutellum which is not subdivided into a dorsal and posterior surface by a circumscutellar carina or varying sculpture dorsally and posteriorly (Fig. 4 E). In other species, there is a more or less clear division by the circumscutellar carina and different sculpture dorsally and posteriorly.</p><p>The mesoscutum has rows of setae mediolaterally, just as in the smaller L. australis (Fig. 11 A, susceptible to damage). None of the other species exhibit these rows of setae.</p><p>The metapleural ridge 1 reaches to about half the length of the metapleuron (Fig. 4 D), as in L. longipes . The other species either possess a longer ridge 1 ( L. japonica and L. heterotoma), a shorter ( L. australis and L. fimbriata), or an absent one ( L. boulardi).</p><p>The metapleural ridge 2 is shorter than half the length of the metapleuron (Fig. 4 D) as in L. australis, L. boulardi and L. fimbriata . In all other species, ridge 2 is at least half the length of the metapleuron.</p><p>Molecular characterisation.</p><p>Maximum intraspecific barcode-distance: - % (1).</p><p>Minimum interspecific barcode-distance: 14.3 % ( L. longipes).</p><p>CO 1 barcode sequence: 658 bp.</p><p>5 ’ - TTTAATATATTTTATATTTGGAATTTGGTCAGGGATAGTAGGAGCAAGATTAAGAATAATTATTCGATTAGAGTTAGGAACTCCTGGGCAGTTAATTAATAATGACCAGATTTATAATTCTATAGTGACTGTTCATGCTTTTGTTATAATTTTTTTTATAGTTATGCCTATTATAGTAGGAGGATTTGGTAATTATTTAGTTCCTTTAATAGTTACAGTTCCTGATATGGCTTTTCCTCGTTTAAATAATATGAGATTATGACTTTTATTTCCTTCTTTAATTTTAATGTTAGCTAGTATATTTATTGATCAAGGAGCAGGAACTGGGTGAACTGTGTATCCTCCTCTTTCTTTAAGTGTAAGGCATCCTGGAGTAGCTGTAGATTTAATTATTTTTTCTTTACATTTAAGAGGGGTTTCATCAATTTTAGGGTCTATTAATTTTATTTCTACAATTTTTAATATTCGTCCATTGTTAATAGGGATAGATAAAATTACTTTATTTTTATGATCTATTTTTTTAACAACTATTTTATTATTACTTTCTTTACCTGTATTAGCAGGAGGGATTACAATATTATTATTTGACCGTAATTTAAATACTTCTTTTTATGATCCAGTTGGGGGTGGGGATCCAATTTTGTATCAACATTTATTT- 3 ’.</p><p>Biology.</p><p>Habitat. Occurs in forests (coniferous and deciduous), open meadows and pastures, if they are more or less damp and contain mushrooms and decaying plant material (e. g. beech forest, spruce plantation, oak grove, railway bank between pastures, alpine meadow, wet mowing meadow). Emerged from decaying mushrooms: Amanita phalloides (Vaill. ex Fr.) Link, 1833 (death cap), Imleria badia (Fr.) Vizzini, 2014 (bay bolete, reported as Boletus badius (Fr.) Fr., 1832), Phallus impudicus, Russula cyanoxantha (Schaeff.) Fr., 1863 (variegated russula), Megacollybia platyphylla (Pers.) Kotl. &amp; Pouzar, 1972 (whitelaced shank, reported as Tricholomopsis platyphylla (Pers.) Singer, 1939), also from decaying petioles of Heracleum mantegazzianum . Rarely collected in Malaise traps or by sweep netting.</p><p>Flight period. May to November, seemingly earlier in southern Europe (May to October, most abundant in June and July) than in northern Europe (July to November, most abundant in August).</p><p>Hosts. Fungivorous Drosophilidae of the Drosophila quinaria species group. Mostly taken from D. phalerata (Vet 1983; van Alphen and Vet 1986; Driessen et al. 1990), also from D. subobscura, D. kuntzei and D. transversa (Driessen et al. 1990) .</p><p>Ex situ: Reared from Scaptomyza pallida (Eijs and van Alphen 1999) and with lower success rates from Drosophila melanogaster (Pannebakker et al. 2008) .</p><p>Population parameters. Host and habitat overlap with L. australis and L. longipes (Nordlander 1980; van Alphen et al. 1991; Lue et al. 2016), also L. heterotoma (Driessen et al. 1990) . Mean developmental time in the field: 50 days, with the males taking 2.7 days longer; entering diapause mid-July in the Netherlands which indicates discrete generations (Driessen et al. 1990). Thelytokous with occasional development of males (Driessen et al. 1990; van Alphen et al. 1991), though there is geographic variation within Europe: Arrhenotokous populations are present in the south, which are not infested with Wolbachia (Pannebakker et al. 2004; Wachi et al. 2015).</p><p>Distribution.</p><p>Possibly Holarctic: in Europe mainly in Northern and central parts, records from Austria, Belgium (new record), Czech Republic, Denmark, Estonia, Finland, Germany (locus typicus of Cothonaspis clavipes), the Netherlands, Norway, Spain, Sweden, and United Kingdom. Also present in eastern USA (and likely Canada, but none of the records confirmed), Japan, and Argentina.</p><p>Remarks.</p><p>The species was diagnosed and redescribed in Lue et al. (2021).</p><p>We sequenced one specimen from one location of L. clavipes . On BOLD, four BINs include specimens identified as L. clavipes: BOLD: ACB 6926, BOLD: ACB 7032, BOLD: AEH 2594 and BOLD: AEH 2595. Our sequence falls inside the BIN BOLD: ACB 7032. Inside this BIN are two additional specimens identified as L. clavipes, one of which was identified by Chia-Hua Lue who is the first author of the Nearctic Leptopilina revision (Lue et al. 2016). BOLD: ACB 6926 contains eight specimens in total. They are identified as Leptopilina maia Lue &amp; Buffington, 2016 (2), L. sp. (1), L. sp. 3 (4) and L. clavipes (1). The BIN matches sequences of L. maia in the DROP database. The BINs BOLD: AEH 2594 and BOLD: AEH 2595 are represented by several specimens that are collected in either the US or Canada. It is likely that these specimens are misidentified as L. clavipes and represent one or two different species, possibly belonging to some undescribed Nearctic species near L. clavipes available in collections (MF personal observation).</p></div>	https://treatment.plazi.org/id/2012FC72C15F5DE684CF89AB98F0A56E	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Vogel, Jonathan;Martin, Jakob;Forshage, Mattias;Salden, Tobias;Staverløkk, Arnstein;Verheyde, Fons;Nordlander, Göran;Herz, Annette;Peters, Ralph S.	Vogel, Jonathan, Martin, Jakob, Forshage, Mattias, Salden, Tobias, Staverløkk, Arnstein, Verheyde, Fons, Nordlander, Göran, Herz, Annette, Peters, Ralph S. (2025): The Leptopilina Förster, 1869 of the Western Palearctic, and an updated list of the world species (Hymenoptera, Figitidae, Eucoilinae). Journal of Hymenoptera Research 98: 915-969, DOI: 10.3897/jhr.98.165583
74160433797A517DAED54382B5904E0B.text	74160433797A517DAED54382B5904E0B.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Leptopilina fimbriata (Kieffer 1901)	<div><p>Leptopilina fimbriata (Kieffer, 1901)</p><p>Erisphagia longipes Cameron, 1883: 371 .</p><p>Eucoela (Eucoela) fimbriata Kieffer, 1901: 174 .</p><p>Psilosema (Erisphagia) xanthopum Kieffer, 1904: 605 .</p><p>Psilosema (Erisphagia) filicorne Kieffer, 1904: 606–607 .</p><p>Psilosema longicornis Kieffer, 1907: 619 .</p><p>Episoda dolichocera Hellén, 1960: 19–20.</p><p>Diagnosis.</p><p>Leptopilina fimbriata is a small to medium-sized species (up to 1.6 mm ♀ body length) with slender appearance and remarkably long and filiform antennae in both sexes reaching more than 1.0 times the body length in females and more than 1.9 times the body length in males (Fig. 5 A). The metasoma is significantly paler than head and mesosoma, a pattern similar as in L. longipes, but more distinct. Also, the legs are strikingly stramineous (Fig. 5 A), while they are generally darker (brownish to reddish) in all other species.</p><p>Additionally, the mesoscutellar plate is usually notably circular and short in dorsal view (Fig. 5 C), and elevated and strongly sloping posteriorly in lateral view (Fig. 5 A). Other species possess either a rhombic ( L. heterotoma) or drop-shaped (all other species), not notably short or elevated mesoscutellar plate, only slightly sloping posteriorly in L. longipes .</p><p>The metapleural ridge 1 is shorter than half the length of the metapleuron (Fig. 5 D) as in L. australis and L. clavipes . In other species, ridge 1 is at least half as long as the metapleuron, if present at all. The metapleural ridge 2 is shorter than half the length of the metapleuron (Fig. 5 D), as in L. australis, L. boulardi, and L. clavipes . In other species, ridge 2 is at least half as long as the metapleuron. The forewing is long with a narrow marginal cell. The forewing vein Rs is clearly longer than 2 r, and the accessory veins (M, Rs + M CU 1 and CU 1 a) are usually very distinct (Fig. 12 B), while they are faint or absent in other species.</p><p>Superficially, L. fimbriata is quite similar to Ganaspis seticornis Hellén, 1960 . This is another eucoiline species from a genus potentially associated with Drosophila and the most slenderly built European species in that genus. However, these genera are not closely related. Ganaspis is having far more of a hairy ring, less of a petiolar rim, a long row of setae on the metacoxae, and modified F 1 instead of F 2 in the male antenna.</p><p>Molecular characterisation.</p><p>Maximum intraspecific barcode-distance: 1.4 % (37).</p><p>Minimum interspecific barcode-distance: 13.0 % ( L. japonica).</p><p>Consensus barcode sequence: 658 bp.</p><p>5 ’ - AGTTATATATTTTATTTTTGGGATTTGATCTGGGATAGTGGGGGCGAGATTGAGGATAATTATTCGTATAGAATTGGGGATACCGGGGCAGTTAATTAATAATGATCAAGTTTATAATACTATTGTTACGGCTCATGCATTTATTATAATTTTTTTTATAGTGATACCTATTATAGTTGGTGGGTTTGGGAACTATTTAATTCCTTTAATAATTACAGTTCCTGATATGGCGTTTCCTCGATTAAATAATATAAGATTATGACTTTTATTTCCTTCTTTATTTTTAATGTTAGCTAGAATATTTATTGATCAGGGGGCCGGGACAGGATGAACTGTTTATCCCCCTTTATCTTTAAGAATTGGGCATCCGGGGGTTTCTGTTGATTTAGTGATTTTTTCGTTACATTTAAGGGGGGTTTCTTCTATTTTGGGGTCAATTAATTTTATTTCTACTATTTTAAATGTTCGTCCAAATTTAATAATAATGGATAAAGTTACTTTATTTATTTGGTCTATTTTTTTAACAACTATTTTATTACTGTTATCTTTACCGGTATTAGCTGGGGGGATTACAATATTATTATTTGATCGTAATTTAAATACTTCTTTTTATGATCCTGTGGGAGGGGGGGATCCAATTTTGTATCAACATTTATTT- 3 ’.</p><p>Biology.</p><p>Habitat. Occurs in open and forested sites, as long as there is a layer of leaf litter, but preferrably in structure- and nutrient-rich and more or less damp habitats (e. g. lush garden, alluvial forest, spruce forest, beech forest, young aspen forest, open oak forest, abandoned meadow, shrubby meadow, open sandy pine forest, manure heap in open farmland, calcareous fen, reedbed). Emerged from decaying plant matter (e. g. beet leaves) and Heracleum mantegazzianum . Common in Malaise trap and sweep net samples.</p><p>Flight period. In Europe, from May to late September, but spring records are sparse and there is a peak in July and August. In Macaronesia also occurring throughout winter.</p><p>Hosts. Specialist which has only been found to parasitise Scaptomyza pallida (van Alphen and Vet 1986, no specifics mentioned on the methodology, but seemingly an in situ observation) and Drosophila subobscura (van Alphen &amp; Vet pers comm. in Carton et al. 1986).</p><p>Distribution.</p><p>Palearctic species. Present in Austria, Belgium, the Canary Islands, Czech Republic, Denmark, Estonia, Finland (locus typicus of Episoda dolichocera), France (locus typicus of Eucoela fimbriata, Psilosema xanthopum, Psilosema filicorne and Psilosema longicornis), Georgia, Germany, Greece, Italy, Lithuania, Madeira, the Netherlands, Norway, Poland, Portugal, Russia, Slovenia, Spain (locus typicus of Erisphagia longipes), Sweden, Switzerland, Ukraine, and the United Kingdom. Further East, the species was also recorded from Kyrgysztan and China (BOLD). The published record from the Afrotropical region (van Noort et al. 2015) may be a mistake and requires substantiation.</p><p>Remarks.</p><p>The first available name for this species is Erisphagia longipes Cameron, 1883 . However, after moving it to Leptopilina, it became a junior homonym of L. longipes (Hartig, 1841) (Nordlander, 1980) . Leptopilina fimbriata (Kieffer, 1901), as the second-oldest name, thereby serves as the valid name.</p><p>We sequenced 37 specimens of L. fimbriata from 11 localities. On BOLD, this species is represented by a single BIN: “ BOLD: ACO 1262 ”. Our CO 1 sequences are the first representatives of L. fimbriata in DROP.</p></div>	https://treatment.plazi.org/id/74160433797A517DAED54382B5904E0B	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Vogel, Jonathan;Martin, Jakob;Forshage, Mattias;Salden, Tobias;Staverløkk, Arnstein;Verheyde, Fons;Nordlander, Göran;Herz, Annette;Peters, Ralph S.	Vogel, Jonathan, Martin, Jakob, Forshage, Mattias, Salden, Tobias, Staverløkk, Arnstein, Verheyde, Fons, Nordlander, Göran, Herz, Annette, Peters, Ralph S. (2025): The Leptopilina Förster, 1869 of the Western Palearctic, and an updated list of the world species (Hymenoptera, Figitidae, Eucoilinae). Journal of Hymenoptera Research 98: 915-969, DOI: 10.3897/jhr.98.165583
13E31EB69EB5510989F484D558B80670.text	13E31EB69EB5510989F484D558B80670.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Leptopilina Forster 1869	<div><p>Genus Leptopilina Förster, 1869</p><p>Type species.</p><p>Leptopilina longipes (Hartig, 1841) .</p><p>Diagnosis.</p><p>Leptopilina species are recognized from other cynipoid wasps by having a mesoscutellar plate (as do all members of the Eucoilinae subfamily), the dorsally broadly interrupted to almost absent hairy ring of the metasoma (dorsally shortly interrupted, absent, or complete in other eucoiline genera) in combination with the postpetiolar rim (absent in most genera, e. g. Ganaspis Förster, 1869 and Hexacola Förster, 1869, present in Cothonaspis Hartig, 1840, Diglyphosematini, and Zaeucoilini; these usually lack a hairy ring). Female specimens have 13 antennomeres, while male specimens have 15. In males, the second flagellomere (F 2) is curved and somewhat irregular (unlike in several other groups of Eucoilinae, where the first flagellomere (F 1) is irregular).</p><p>Leptopilina species can have their hairy ring reduced and species of Diglyphosematini, Zaeucoilini or Cothonaspis can developed an unusually distinct hairy ring. In these cases, Leptopilina can be differentiated from the Diglyphosematini and Zaeucoilini by having a regularly wide pronotum without distinct shoulders (very broad pronotum with distinct shoulders in Diglyphosematini and Zaeucoilini). Additionally, the male F 1 is modified in Diglyphosematini and Zaeucoilini and the metasoma is roundish, not longer than high in Diglyphosematini and Zaeucoilini (more elongate in Leptopilina). In comparison to Cothonaspis, Leptopilina species have a much less elongate appearance, especially the mesosoma is less elongate in Leptopilina, with a mesoscutum about as long as wide (clearly longer than wide in Cothonaspis), and the propodeal area is much more setose in Leptopilina (hardly any seta in Cothonaspis).</p><p>Remarks.</p><p>A more extensive diagnosis can be found in Lue et al. (2016).</p><p>The name Leptopilina was not frequently used after its original description by Förster (1869). Kieffer, who was generally circumscribing taxa by a minimal set of a priori chosen diagnostic characters and did not study types, collected a somewhat haphazard assembly of species under the name Leptopilina in his Cynipoidea world monograph (von Dalla-Torre and Kieffer 1910). His concept of the genus was of limited use, so that for 70 years, only a single species was described in it. Later, Nordlander revisited eucoiline classification based on type studies and phylogenetic concerns. His type studies showed that some of the species, which had been described by 19 th century authors and that he could not immediately associate with a genus name, were not currently classified in a meaningful way. The genus name Leptopilina was not in use by these authors, despite being available since Förster (1869). And it turned out that two slightly better known yet misclassified species belonged there ( L. heterotoma and L. boulardi, then known as Pseudeucoila bochei Weld, 1944 and Cothonaspis boulardi Barbotin, Carton &amp; Kelner-Pillault, 1979 respectively). Thus, it is from Nordlander’s revival of the genus (1980) that the modern sense and use of the name originates.</p><p>Leptopilina is currently classified as belonging to the tribe Eucoilini together with the type genus Eucoila Westwood, 1833, the genera Afrodontaspis Weld, 1962, Bothrochacis Cameron, 1904, Linaspis Lin, 1988, Linoeucoila Lin, 1988, Maacynips Yoshimoto, 1963, Quasimodoana Forshage, Nordlander &amp; Ronquist, 2008, and the far more common Trybliographa Förster, 1869 (Buffington et al. 2020). The Eucoilini as currently defined seemed monophyletic only in the analyses of Fontal-Cazalla et al. (2002) (morphological characters) and Forshage et al. (2008) (European taxa only, morphological characters), while already the first combined analysis using molecular and morphological data (Buffington et al. 2007) resulted in a more problematic topology with the Eucoilini as a paraphyletic grade leading up to Trichoplastini, and some other genera complicating the picture further. An additional difficulty is that some of these genera are much more poorly known than Leptopilina and not necessarily well circumscribed (such as Maacynips and Leptolamina Yoshimoto, 1962). Recent analyses (Blaimer et al. 2020; Guinet et al. 2025, and unpublished results) have retained a problematic picture with a non-monophyletic Eucoilini, but the taxon sampling has not been broad enough and the results not stable enough to suggest a new improved classification with monophyletic and recognisable tribes, so this task remains to be undertaken.</p><p>Leptopilina novicia Belizin, 1964 was described from Armenia so it is a Western Palearctic species, but it does not belong in Leptopilina and is here formally moved to Hexacola resulting in the comb. nov. Hexacola novicia (Belizin, 1964), as was suggested in the now offline Fauna Europaea database (Ronquist and Forshage 2004). The type is held at ZIN and was studied by GN and MF.</p><p>Body size varies greatly within species in Leptopilina (as is common in parasitoids), and is something like 1.0– 2.2 mm across the genus (not considering occasional rare aberrant specimens that are even smaller or larger). For those species of which we have studied numerous specimens, the average body size falls in either the higher or lower part of this range. Deviations from the average usually peak around the opposite end with a more or less distinct gap between the average and the deviant group of specimens. For this reason, we give body size mainly in relative terms in the species diagnoses of these species.</p></div>	https://treatment.plazi.org/id/13E31EB69EB5510989F484D558B80670	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Vogel, Jonathan;Martin, Jakob;Forshage, Mattias;Salden, Tobias;Staverløkk, Arnstein;Verheyde, Fons;Nordlander, Göran;Herz, Annette;Peters, Ralph S.	Vogel, Jonathan, Martin, Jakob, Forshage, Mattias, Salden, Tobias, Staverløkk, Arnstein, Verheyde, Fons, Nordlander, Göran, Herz, Annette, Peters, Ralph S. (2025): The Leptopilina Förster, 1869 of the Western Palearctic, and an updated list of the world species (Hymenoptera, Figitidae, Eucoilinae). Journal of Hymenoptera Research 98: 915-969, DOI: 10.3897/jhr.98.165583
8BE5EAD9D28E5D0880650B05D5BA0AC9.text	8BE5EAD9D28E5D0880650B05D5BA0AC9.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Leptopilina heterotoma (Thomson 1862)	<div><p>Leptopilina heterotoma (Thomson, 1862)</p><p>Eucoila heterotoma Thomson, 1862: 403 .</p><p>Ganaspis subnuda Kieffer, 1904: 6 .</p><p>Ganaspis monilicornis Kieffer, 1904: 622–623 .</p><p>Erisphagia philippinensis Kieffer, 1916: 282 .</p><p>Pseudeucoila bochei Weld, 1944: 65–66 .</p><p>Diagnosis.</p><p>Leptopilina heterotoma is a size-variable species but on average large (frequently around 2 mm ♀ body length) with a robust appearance and medium-long antennae (Fig. 6 A).</p><p>The species possesses a uniquely large mesoscutellar plate which is widest in its anterior half, making it rhombic in shape (Fig. 6 C). However, the shape is varying slightly and can overlap with that of L. japonica and vice versa. The dorsal profile of the mesoscutellar plate usually appears s-shaped in L. heterotoma and is more evenly convex in L. japonica . The mesoscutellar plate is either more or less circular in L. fimbriata or less elongate drop-shaped in all other species.</p><p>The metapleural ridges 1 and 2 are reaching (or almost so) the anterior margin of the metapleuron (Fig. 6 E), as in L. japonica . The ridges 1 and 2 of the other species, if present, reach at most to half the length of the metapleuron. The sculpture of the dorsal surface of the mesoscutellum is mediolaterally areolate. This is somewhat similar to the striae of L. boulardi, though the striae in L. heterotoma are more equally distributed along the mesoscutellar plate (Fig. 6 C), while they are radiating from the base of the mesoscutellar plate in L. boulardi . The sculpture of all other species is usually foveate-reticulate. The base of the metacoxa has a setal patch (Fig. 6 E), like most other species. Only L. japonica and L. boulardi have either no patch or at most a few singular setae.</p><p>L. heterotoma can be confused with small species of Trybliographa, which are similar and closely related but they have a full hairy ring and lack the petiolar rim.</p><p>Molecular characterisation.</p><p>Maximum intraspecific barcode-distance: 1.1 % (45).</p><p>Minimum interspecific barcode-distance: 11.7 % ( L. japonica).</p><p>Consensus barcode sequence: 658 bp.</p><p>5 ’ - TATTATATATTTTATATTTGGAATTTGATCAGGGATAGTAGGGGCAGGGTTAAGGTTGATTGTTCGGATAGAGTTAGGTATACCAGGTCAATTAATTAATAATGATCAAATTTATAATTCTATTGTTACTGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCAATTATAGTTGGAGGATTTGGGAATTATTTAATTCCATTAATACTTACAGTTCCTGATATAGCATTTCCACGTTTAAATAATATAAGTTTATGACTTTTATTTCCTTCTATGATTTTAATATTAGCAAGAATAATAATTGACCAAGGGGCAGGAACAGGATGAACTGTTTACCCTCCTTTATCTCTTAGAGATAGACATCCTGGGGTTTCAACTGATTTAGTAATTTTTTCATTACATTTAAGGGGGGTATCTTCAATTTTAGGGTCTATTAATTTTATTTCAACAATTATTAATATACGACCTTATTTAATATCAATAGATAAAATTACATTATTTGTTTGAGCAATTTTTTTAACAACTATTCTTTTATTGTTATCATTACCTGTTTTAGCAGGAGGAATTACAATATTATTATTTGATCGAAATTTAAATACTTCTTTTTATGATCCTGTTGGAGGAGGAGATCCAATTTTGTATCAACATTTATTT- 3 ’.</p><p>Biology.</p><p>Habitat. Occurs in both open and forested habitats (nemoral forest, meadows, gardens, orchards), but mainly localities with an abundance of fruit. Most commonly emerging from decaying fruit, less frequently from decaying plant materials, fungi, and tree sap bleed. Common in Malaise trap and sweep net samples.</p><p>Flight period. April to October in Europe but common only in July and August. Occurring throughout winter in Macaronesia.</p><p>Hosts. Generalist with a wide host range, predominantly in fruit-inhabiting Drosophila: Drosophila busckii, D. buzzatii Patterson &amp; Wheeler, 1942, D. funebris (Fabricius, 1787), D. immigrans, D. kuntzei, D. melanogaster, D. obscura Fallén, 1823, D. phalerata, D. simulans, D. subobscura, additionally, there are several hosts that are not present in the Western Palearctic: Drosophila americana Spencer, 1938, D. bocqueti Tsacas &amp; Lachaise, 1974, D. malerkotliana Parshad &amp; Paika, 1965, D. teissieri, D. yakuba Burla, 1954 (rev. in Carton et al. 1986; Carton and Nappi 1991).</p><p>Also found in D. limbata in decaying plant materials ( Heracleum mantegazzianum) (Vet and van Alphen 1985; van Alphen et al. 1991). Present in sap bleed of Quercus robur L. and Acer pseudoplatanus L., but not of Hippophae rhamnoides L. (Janssen et al. 1988). Low levels of parasitoidism in fungivorous hosts (Phallus impudicus, Imleria badia): Drosophila immigrans, D. kuntzei, D. phalerata, D. picta Zetterstedt, 1847 (Janssen et al. 1988; Driessen et al. 1990; Poolman Simons et al. 1992).</p><p>Ex situ: Reared from D. bifasciata Pomini, 1940 (Wachi et al. 2015), D. hydei Sturtevant, 1921 (Xie et al. 2010), D. virilis, and Scaptomyza pallida (Eijs and van Alphen 1999) and the non-Western Palearctic species D. nigromaculata Kikkawa &amp; Peng, 1938, D. orientacea Grimaldi, James &amp; Jaenike, 1992 (Wachi et al. 2015), D. erecta, D. eugracilis, D. lutescens Okada, 1975, D. mauritiana, D. pseudoobscura, D. robusta Sturtevant, 1916, D. santomea Lachaise &amp; Harry, 2000, D. sechellia, D. willistoni Sturtevant, 1916, and Zaprionus vittiger Coquillett, 1901 (Schlenke et al. 2007).</p><p>No successful development in D. suzukii (Chabert et al. 2012), because eggs get hemocytically encapsulated (Poyet et al. 2013).</p><p>Population parameters. The most generalist Leptopilina species, predominant in northern France throughout the season and less frequent in the Mediterranean; it competes with L. boulardi where the geographical range overlaps and populations appear and peak before L. boulardi (Fleury et al. 2004, 2009; Mazzetto et al. 2016). Hosts are attacked at random, but superparasitoidism is avoided and increases with parasitoid density (van Alphen and Vet 1986). In cool temperate regions of Japan, female adults overwinter as a free-living adult while other stages and male adults die (Kimura 2019). It is pro-ovigenic (Vuarin et al. 2012) and infection with Wolbachia is possible (Vavre et al. 2009).</p><p>Distribution.</p><p>Cosmopolitan species, widespread in the Western Palearctic: Austria, the Azores, Belgium, Bulgaria, the Canary Islands, Czech Republic, Finland, France (locus typicus of Ganaspis monilicornis), Germany, Greece, Ireland, Israel, Italy, Madeira, the Netherlands, Norway, Slovenia, Spain, Sweden (locus typicus of Eucoila heterotoma), Switzerland, Tunisia, Turkey, and the United Kingdom. In Eastern Palearctic: Japan; in North America: eastern USA (locus typicus of Pseudeucoila bochei), and Canada; in tropical Asia: the Philippines (locus typicus of Erisphagia philippinensis), in the Afrotropics: Democratic Republic of the Congo, Madagascar, and St Helena; and in Australia and Vanuatu.</p><p>Remarks.</p><p>A comprehensive review on L. heterotoma was recently published by Quicray et al. (2023).</p><p>While Novković et al. (2011) found high intra-specific genetic differences between the CO 1, ITS 1 and ITS 2 sequences of (a limited number of) Japanese specimens of L. heterotoma and specimens of a French laboratory strain, questioning whether they were the same species, we could not contribute to solving this issue as our material was exclusively from the Western Palearctic region.</p><p>We sequenced 45 specimens of L. heterotoma from 36 localities. The currently available sequences on BOLD represent a single BIN “ BOLD: ACB 8464 ”. Three sequences in DROP (voucher IDs 339, 864 and 817) cluster close together with L. heterotoma, but show a high difference (&gt; 6 %) to the otherwise comparably homogenous L. heterotoma sequences, while two of them (339 and 864) are identified as L. heterotoma and the other one (817) as unidentified Leptopilina .</p></div>	https://treatment.plazi.org/id/8BE5EAD9D28E5D0880650B05D5BA0AC9	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Vogel, Jonathan;Martin, Jakob;Forshage, Mattias;Salden, Tobias;Staverløkk, Arnstein;Verheyde, Fons;Nordlander, Göran;Herz, Annette;Peters, Ralph S.	Vogel, Jonathan, Martin, Jakob, Forshage, Mattias, Salden, Tobias, Staverløkk, Arnstein, Verheyde, Fons, Nordlander, Göran, Herz, Annette, Peters, Ralph S. (2025): The Leptopilina Förster, 1869 of the Western Palearctic, and an updated list of the world species (Hymenoptera, Figitidae, Eucoilinae). Journal of Hymenoptera Research 98: 915-969, DOI: 10.3897/jhr.98.165583
89E8D9F073495BD684F794BA56F9F296.text	89E8D9F073495BD684F794BA56F9F296.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Leptopilina japonica Novkovic & Kimura 2011	<div><p>Leptopilina japonica Novković &amp; Kimura, 2011</p><p>Leptopilina japonica japonica Novković &amp; Kimura, 2011: 341–343.</p><p>Diagnosis.</p><p>Leptopilina japonica is a large species (usually around 2 mm ♀ body length) with a robust appearance and medium-long antennae (Fig. 7 A).</p><p>The species is, together with L. boulardi, characteristic in having at most a few singular setae on the base of the metacoxa instead of a distinct setal patch (Fig. 7 D), which is typical for all other species. Leptopilina japonica differs from L. boulardi by the distinct metapleural ridges 1 and 2 that almost reach the anterior metapleural margin (Fig. 7 D). The extension of the ridges 1 and 2 is shared with L. heterotoma, while all other species have significantly shorter or no ridges. The mesoscutellar plate is similar in shape to that of L. heterotoma, being more elongate than those of the other species, but L. heterotoma has a typically rhombic mesoscutellar plate, while it is more drop-shaped, being widest in the posterior half, in L. japonica (Fig. 7 C). The shape is however rather variable and may overlap between the two species. The lateral view of the mesoscutellar plate usually appears s-shaped in L. heterotoma and is more evenly convex in L. japonica . The sculpture of the dorsal surface of the mesoscutellum is mediolaterally foveate-reticulate, as in most other species (Fig. 7 C). Only L. boulardi and L. heterotoma are areolate instead. The mesoscutellar surface sometimes has additional concentric striae (as in Fig. 7 C).</p><p>Molecular characterisation.</p><p>Maximum intraspecific barcode-distance: 0.6 % (6).</p><p>Minimum interspecific barcode-distance: 11 % ( L. heterotoma).</p><p>Consensus barcode sequence: 658 bp.</p><p>5 ’ - TGTAATGTATTTTGTTTTTGGTATTTGGTCTGGGATAGTGGGGGCTGGGTTAAGATTCCTTGTTCGTACAGAATTAGGGATACCTGGGCAGTTGATTAATAATGATCAAATTTATAATTCAATTGTAACTGCTCATGCTTTTGTTATAATTTTTTTTATAGTGATACCAATTATGGTTGGGGGGTTTGGCAATTATTTAGTACCATTAATATTAACTGTTCCTGACATAGCTTTCCCTCGATTGAATAATATAAGATTATGATTATTATTTCCTTCAATGATTTTAATGGTGGCAAGGATGATAATTGATCAAGGGGCAGGGACAGGGTGAACGGTTTATCCTCCTTTATCTTTAATAGATAGTCATCCTGGGGTTTCTACTGATTTAGTAATTTTTTCATTACATTTAAGAGGGGTATCTTCGATTTTAGGGTCAATTAATTTTATTTCTACTATTATTAATATACGTCCTTATTTAATAACAATAGATAAAATTACTTTATTTATTTGAGCTATTTTTTTAACAACAATTCTTTTATTATTATCTTTACCTGTTTTAGCAGGGGGGATTACTATATTATTATTTGATCGTAATTTAAATACTTCTTTTTATGATCCTGTTGGAGGGGGGGACCCAATTTTGTATCAACATTTATTT- 3 ’.</p><p>Biology.</p><p>Habitat. Outside of the native range in East Asia, mostly found in orchards, parks, residential areas, and forests, if they contain suitable plants for D. suzukii, in the native range found in forests. Common in Malaise trap and sweep net samples.</p><p>Flight period. In Europe, from May to November, but most abundant in late summer.</p><p>Host. In the native range, L. japonica has been reared from Drosophila suzukii (Daane et al. 2016) and the non-Western Palearctic hosts D. biauraria Bock &amp; Wheeler, 1972, and D. rufa Kikkawa &amp; Peng, 1938 (Novković et al. 2011).</p><p>Ex situ, it has also been reared from D. bifasciata, D. busckii, D. funebris, D. immigrans, D. melanogaster, D. simulans, and D. subobscura (Novković et al. 2011; Kimura and Novković 2015; Girod et al. 2018 a; Daane et al. 2021) and the non-Western Palearctic hosts D. auraria Peng, 1937, D. sp. aff. bicornuta Bock &amp; Wheeler, 1972, D. bipectinata Duda, 1923, D. bocki Baimai, 1979, D. lutescens, D. montana Patterson &amp; Wheeler, 1942, D. orientacea, D. persimilis Dobzhansky &amp; Epling, 1944, D. pseudoobscura, D. robusta, D. sulfurigaster (Duda, 1923), D. takahashii Sturtevant, 1927, and Hirtodrosophila duncani (Sturtevant, 1918), but with very mixed success rates (Kimura and Novković 2015; Daane et al. 2021). Another three species were attacked with no parasitoid emergence (Kimura and Novković 2015). Parasitoidism success may depend on the geographic origin of parasitoid or host (Kimura and Novković 2015; Girod et al. 2018 a).</p><p>Unlike native Leptopilina species from the Western Palearctic, L. japonica can overcome the immune response of D. suzukii (Chabert et al. 2012) . While it has also been collected together with closely related Drosophila, L. japonica is associated with D. suzukii in the native ranges (Girod et al. 2018 b; Matsuura et al. 2018) and in the non-native ranges. In North America, in situ parasitoidism of the Drosophila obscura species group and the D. melanogaster species group has been observed (Paul K. Abram personal communication). As a result of the close association with D. suzukii in the Western Palearctic, L. japonica has mostly been found in habitats with fruiting plants that host D. suzukii (Abram et al. 2022; Gariepy et al. 2024; Rossi-Stacconi et al. 2025).</p><p>Population parameters. Moderately pro-ovigenic (Wang et al. 2018), no Wolbachia infection is known (Wachi et al. 2015). Forming multiple generations per season (Rossi-Stacconi et al. 2025).</p><p>Distribution.</p><p>Non-native species in the Western Palearctic, originally from East Asia. In Europe since 2019: present in Belgium (since 2022, new record), France (since 2022, Rousse et al. 2023), Germany (since 2021, Martin et al. 2023), Italy (since 2019, Puppato et al. 2020), Switzerland (since 2021, Rossi-Stacconi et al. 2025), and the United Kingdom (since 2024, Powell et al. 2025). In Asia present in China (Daane et al. 2016), Japan (Novković et al. 2011), and South Korea (Giorgini et al. 2019). It has spread to Canada since 2016 (Abram et al. 2020) and to the USA since 2020 (Beers et al. 2022). Records in 2023 and 2024 from Northern Germany in the state of Brandenburg represent the globally northernmost detections of this species so far (Rossi-Stacconi et al. 2025).</p><p>Remarks.</p><p>A comprehensive review on L. japonica was recently published by Rossi-Stacconi et al. (2025).</p><p>In their original description, Novković &amp; Kimura separated L. japonica into two subspecies: the subtropical Leptopilina japonica formosana Novković &amp; Kimura, 2011, found in Taiwan, and the temperate Leptopilina japonica japonica Novković &amp; Kimura, 2011, found in Japan (Novković et al. 2011; Murata et al. 2013). In accordance with the respective climatic preferences reported by Murata et al. (2013), populations in Europe and North America have been identified to belong to L. j. japonica (Gariepy et al. 2024; Rossi-Stacconi et al. 2025). In this publication, we exlusively refer to L. j. japonica when we write L. japonica . Novković et al. (2011) describe the separation of the subspecies as challenging, as the described diagnostic differences consist only of the darker antenna and a narrower and elongated mesoscutellar plate of L. j. formosana compared to L. j. japonica . However, the subspecies are in need of taxonomic re-evaluation and will likely be elevated to species-rank based on genetic and morphological data (Ionela-Madalina Viciriuc and Matthew L. Buffington pers. comm.).</p><p>The data provided here contain two hitherto unpublished records of L. japonica collected in 2022, one from Bonn (Germany, ZFMK -TIS-2637732) and the other collected in Ypres (Belgium, ZFMK -TIS-2637792). The latter represents a new country record and is, together with the recently published record from the United Kingdom (Powell et al. 2025), another indicator of the rapid spread of L. japonica within Europe.</p><p>The absence of the setal patch on the metacoxal base is a previously unrecognised character that is consistent in both males and females throughout our material and that from the Nearctic (Matt Buffington and Paul K. Abram pers. Comm.). This character, only shared with the otherwise quite distinct L. boulardi, facilitates the diagnosis of L. japonica substantially.</p><p>We sequenced six specimens of L. japonica from two localities. On BOLD, sequences of 499 specimens are recorded, forming three BINs. Our sequences are assigned to the BIN “ BOLD: ACD 4002 ” only. The specimens behind the other two BINs require further taxonomic evaluation.</p></div>	https://treatment.plazi.org/id/89E8D9F073495BD684F794BA56F9F296	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Vogel, Jonathan;Martin, Jakob;Forshage, Mattias;Salden, Tobias;Staverløkk, Arnstein;Verheyde, Fons;Nordlander, Göran;Herz, Annette;Peters, Ralph S.	Vogel, Jonathan, Martin, Jakob, Forshage, Mattias, Salden, Tobias, Staverløkk, Arnstein, Verheyde, Fons, Nordlander, Göran, Herz, Annette, Peters, Ralph S. (2025): The Leptopilina Förster, 1869 of the Western Palearctic, and an updated list of the world species (Hymenoptera, Figitidae, Eucoilinae). Journal of Hymenoptera Research 98: 915-969, DOI: 10.3897/jhr.98.165583
9E9BDCA514485231A547C168B41F61A1.text	9E9BDCA514485231A547C168B41F61A1.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Leptopilina longipes (Hartig 1841)	<div><p>Leptopilina longipes (Hartig, 1841)</p><p>Cothonaspis longipes Hartig, 1841: 356 .</p><p>Eucoila pusilla Giraud, 1860: 142 syn. nov. (type in MNHN studied by MF).</p><p>Rhoptromeris rutilus Belizin, 1966: 12 syn. nov. (type in ZIN studied by GN).</p><p>Diagnosis.</p><p>Leptopilina longipes is a size-variable species with relatively slender appearance, medium-long antennae, and the metasoma is notably paler than the head and mesosoma (Fig. 8 A).</p><p>The species is unique in having the propodeal carina well separated from the mesoscutellum by a part of the metanotum (Fig. 8 E). Other species show at most an insignificant gap.</p><p>The metapleural ridge 1 and 2 are of similar length, reaching about half the length of the metapleuron (Fig. 8 D). In other species, the lengths of ridge 1 and 2 are dissimilar, or they reach the anterior margin of the metapleuron ( L. japonica and L. heterotoma). Whereas other species have a more or less unicoloured body, the metasoma of L. longipes, especially of the females, is distinctly paler amber-coloured than the head and mesosoma (Fig. 8 A). This colouration pattern is similar to that of L. fimbriata, where it is usually even more distinct. The surface anterior to the glandular pit of the mesoscutellar plate is concave and areolate (Fig. 8 C), as it is in L. australis and L. clavipes . That area is mostly smooth in all other species. The female antenna is usually more uniformly dark, with all flagellomeres brown to dark brown (Fig. 8 B), while all other species have at least a few proximal flagellomeres pale brown or even yellow.</p><p>Molecular characterisation.</p><p>Maximum intraspecific barcode-distance: 0.5 % (2).</p><p>Minimum interspecific barcode-distance: 14.3 % ( L. clavipes).</p><p>Consensus barcode sequence: 658 bp.</p><p>5 ’ - TATAATATATTTTATATTTGGTATTTGATCAAGTATAGTAGGGGCAAGGCTAAGAATAATTATTCGAATAGAGTTAGGGACTGTAACTCAGTTAATTAATAATGATCAGATTTATAATTCTATTGTTACGGCTCATGCATTTGTAATAATTTTTTTTATAGTTATACCTATTATAGTGGGAGGGTTTGGTAATTATTTGGTTCCTTTAATAGTTAGAGTTCCTGACATAGCTTTTCCTCGTCTTAATAATATAAGGTTATGATTATTATTTCCTTCTTTAATTTTAATAATTACAAGAATATTTATTGATCAGGGGGCAGGGACTGGGTGAACGGTGTATCCTCCTTTATCTTTATCTATAAGGCATCCTGGTGTGGCACCTGATTTAGTAATTTTTTCTTTACATTTGAGGGGGGTATCTTCAATTTTAGGGGCAATTAATTTTATTACTACAATTATAAATATACGACCAAAAATAATATCTATAGATAAAATTTCTTTATTTGTTTGATCTATTTTTTTAACTACAATTTTACTTTTATTATCTTTACCTGTGTTAGCTGGAGGAATTACAATATTATTATTTGATCGTAATTTAAATACTTCTTTTTATGATCCWATTGGAGGGGGGGAWCCTATTTTGTATCARCATTTATTT- 3 ’.</p><p>Biology.</p><p>Habitat. Occurs in both open and forested localities with mushrooms and decaying plant matter. Found in spruce forests and alder forests, but also in coastal sand dunes. In Japan found mostly in domestic areas. Rarely collected with Malaise traps or by sweep netting.</p><p>Flight period. July to September, with a slight peak in August.</p><p>Hosts. Reared from Scaptomyza pallida and Drosophila quinaria species group: Drosophila kuntzei, D. limbata, D. phalerata and emerged together with these hosts in the Netherlands from decaying plant matter (cucumber bait) (Hardy et al. 1992) and Heracleum mantegazzianum petioles, as well as from Agaricus bisporus (J. E. Lange) Imbach, 1946 (cultivated mushroom) (van Dijken and van Alphen 1998). Also emerged from Fomitopsis pinicola (Sw.) P. Karst., 1881 (red-belted conk), where Leptopilina longipes probably was parasitoid of Leucophenga quinquemaculata Strobl, 1893 (Jonsell et al. 1999). In Japan taken from Drosophila simulans, but also D. immigrans and the non-Western Palearctic D. auraria species complex and D. nigromaculata in banana bait (Kimura 2015).</p><p>Ex situ reared from D. subobscura (Eijs and van Alphen 1999) . Not found in fermenting apples (van Dijken and van Alphen 1998).</p><p>Population parameters. While there are thelytokous populations in Japan (Wachi et al. 2015), samples from Europe include males and females (Nordlander 1980). Probably univoltine (Hardy et al. 1992). In Japan, L. longipes overwinters in prepupal diapause (unpublished data in Kimura 2019). During probing, it holds the antennae remarkably straight and does not touch the substrate; efficient at finding hosts at low densities (van Dijken and van Alphen 1998).</p><p>Distribution.</p><p>Restricted to the Palearctic; mainly northern and central Europe: found in Austria (locus typicus of Eucoila pusilla), Bulgaria, Croatia, Czech Republic, Denmark, Finland, Georgia, Germany (locus typicus of Cothonaspis longipes), Moldova (locus typicus of Rhoptromeris rutilus), the Netherlands, Norway, Sweden, Switzerland, and the United Kingdom. Outside of Europe only known from Japan.</p><p>Remarks.</p><p>We sequenced two specimens of L. longipes from two localities. The currently available sequences on BOLD represent a single BIN “ BOLD: ACS 3295 ”. In DROP, two CO 1 sequences of L. longipes are available, both of which match with our sequences (&lt;2 % difference), though one (voucher ID: 330) is listed as unidentified.</p></div>	https://treatment.plazi.org/id/9E9BDCA514485231A547C168B41F61A1	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Vogel, Jonathan;Martin, Jakob;Forshage, Mattias;Salden, Tobias;Staverløkk, Arnstein;Verheyde, Fons;Nordlander, Göran;Herz, Annette;Peters, Ralph S.	Vogel, Jonathan, Martin, Jakob, Forshage, Mattias, Salden, Tobias, Staverløkk, Arnstein, Verheyde, Fons, Nordlander, Göran, Herz, Annette, Peters, Ralph S. (2025): The Leptopilina Förster, 1869 of the Western Palearctic, and an updated list of the world species (Hymenoptera, Figitidae, Eucoilinae). Journal of Hymenoptera Research 98: 915-969, DOI: 10.3897/jhr.98.165583
