identifier	taxonID	type	CVterm	format	language	title	description	additionalInformationURL	UsageTerms	rights	Owner	contributor	creator	bibliographicCitation
D080BF726518ED82EE1A0AA5347108E9.text	D080BF726518ED82EE1A0AA5347108E9.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Venanus johnnyrosalesi Fernandez-Triana & Whitfield	<div><p>Venanus johnnyrosalesi Fernandez-Triana &amp; Whitfield sp. n.</p> <p>Materials</p> <p>Type status: Holotype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu/caterpillars/database.lasso; catalogNumber: DHJPAR0031445; recordedBy: D.H.Janzen&amp;W.Hallwachs; individualID: DHJPAR0031445; individualCount: 1; sex: Female; lifeStage: adult; otherCatalogNumbers: 08-SRNP-38355; Taxon: scientificName: Venanusjohnnyrosalesi; phylum: Arthropoda; class: Insecta; order: Hymenoptera; family: Braconidae; genus: Venanus; specificEpithet: johnnyrosalesi; scientificNameAuthorship: Fernández-Triana; Location: continent: Central America; country: Costa Rica; stateProvince: Guanacaste; locality: <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=-85.4573&amp;materialsCitation.latitude=10.9333" title="Search Plazi for locations around (long -85.4573/lat 10.9333)">Area de Conservacion Guanacaste</a>; verbatimLocality: Sendero Cima; verbatimElevation: 1460 m; verbatimLatitude: 10.9333; verbatimLongitude: -85.4573; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.9333; decimalLongitude: -85.4573; Identification: dateIdentified: 2014; Event: samplingProtocol: Malaise Trap; verbatimEventDate: 11/17/2008; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: PreservedSpecimen</p> <p>Type status: Paratype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu/caterpillars/database.lasso; catalogNumber: DHJPAR0031434; recordedBy: D.H.Janzen&amp;W.Hallwachs; individualID: DHJPAR0031434; individualCount: 1; sex: Female; lifeStage: adult; otherCatalogNumbers: 08-SRNP-38344; Taxon: scientificName: Venanusjohnnyrosalesi; phylum: Arthropoda; class: Insecta; order: Hymenoptera; family: Braconidae; genus: Venanus; specificEpithet: johnnyrosalesi; scientificNameAuthorship: Fernández-Triana; Location: continent: Central America; country: Costa Rica; stateProvince: Guanacaste; locality: <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=-85.4573&amp;materialsCitation.latitude=10.9333" title="Search Plazi for locations around (long -85.4573/lat 10.9333)">Area de Conservacion Guanacaste</a>; verbatimLocality: Sendero Cima; verbatimElevation: 1460 m; verbatimLatitude: 10.9333; verbatimLongitude: -85.4573; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.9333; decimalLongitude: -85.4573; Identification: dateIdentified: 2014; Event: samplingProtocol: Malaise Trap; verbatimEventDate: 10/27/2008; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: PreservedSpecimen</p> <p>Type status: Paratype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu/caterpillars/database.lasso; catalogNumber: DHJPAR0031452; recordedBy: D.H.Janzen&amp;W.Hallwachs; individualID: DHJPAR0031452; individualCount: 1; sex: Female; lifeStage: adult; otherCatalogNumbers: 08-SRNP-38362; Taxon: scientificName: Venanusjohnnyrosalesi; phylum: Arthropoda; class: Insecta; order: Hymenoptera; family: Braconidae; genus: Venanus; specificEpithet: johnnyrosalesi; scientificNameAuthorship: Fernández-Triana; Location: continent: Central America; country: Costa Rica; stateProvince: Guanacaste; locality: <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=-85.4573&amp;materialsCitation.latitude=10.9333" title="Search Plazi for locations around (long -85.4573/lat 10.9333)">Area de Conservacion Guanacaste</a>; verbatimLocality: Sendero Cima; verbatimElevation: 1460 m; verbatimLatitude: 10.9333; verbatimLongitude: -85.4573; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.9333; decimalLongitude: -85.4573; Identification: dateIdentified: 2014; Event: samplingProtocol: Malaise Trap; verbatimEventDate: 12/01/2008; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: PreservedSpecimen</p> <p>Type status: Paratype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu/caterpillars/database.lasso; catalogNumber: DHJPAR0031455; recordedBy: D.H.Janzen&amp;W.Hallwachs; individualID: DHJPAR0031455; individualCount: 1; sex: Male; lifeStage: adult; otherCatalogNumbers: 08-SRNP-38365; Taxon: scientificName: Venanusjohnnyrosalesi; phylum: Arthropoda; class: Insecta; order: Hymenoptera; family: Braconidae; genus: Venanus; specificEpithet: johnnyrosalesi; scientificNameAuthorship: Fernández-Triana; Location: continent: Central America; country: Costa Rica; stateProvince: Guanacaste; locality: <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=-85.4573&amp;materialsCitation.latitude=10.9333" title="Search Plazi for locations around (long -85.4573/lat 10.9333)">Area de Conservacion Guanacaste</a>; verbatimLocality: Sendero Cima; verbatimElevation: 1460 m; verbatimLatitude: 10.9333; verbatimLongitude: -85.4573; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.9333; decimalLongitude: -85.4573; Identification: dateIdentified: 2014; Event: samplingProtocol: Malaise Trap; verbatimEventDate: 12/15/2008; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: PreservedSpecimen</p> <p>Type status: Paratype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu/caterpillars/database.lasso; catalogNumber: DHJPAR0031456; recordedBy: D.H.Janzen&amp;W.Hallwachs; individualID: DHJPAR0031456; individualCount: 1; sex: Male; lifeStage: adult; otherCatalogNumbers: 08-SRNP-38366; Taxon: scientificName: Venanusjohnnyrosalesi; phylum: Arthropoda; class: Insecta; order: Hymenoptera; family: Braconidae; genus: Venanus; specificEpithet: johnnyrosalesi; scientificNameAuthorship: Fernández-Triana; Location: continent: Central America; country: Costa Rica; stateProvince: Guanacaste; locality: <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=-85.4573&amp;materialsCitation.latitude=10.9333" title="Search Plazi for locations around (long -85.4573/lat 10.9333)">Area de Conservacion Guanacaste</a>; verbatimLocality: Sendero Cima; verbatimElevation: 1460 m; verbatimLatitude: 10.9333; verbatimLongitude: -85.4573; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.9333; decimalLongitude: -85.4573; Identification: dateIdentified: 2014; Event: samplingProtocol: Malaise Trap; verbatimEventDate: 12/15/2008; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: PreservedSpecimen</p> <p>Type status: Paratype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu/caterpillars/database.lasso; catalogNumber: DHJPAR0031461; recordedBy: D.H.Janzen&amp;W.Hallwachs; individualID: DHJPAR0031461; individualCount: 1; sex: Male; lifeStage: adult; otherCatalogNumbers: 08-SRNP-38371; Taxon: scientificName: Venanusjohnnyrosalesi; phylum: Arthropoda; class: Insecta; order: Hymenoptera; family: Braconidae; genus: Venanus; specificEpithet: johnnyrosalesi; scientificNameAuthorship: Fernández-Triana; Location: continent: Central America; country: Costa Rica; stateProvince: Guanacaste; locality: <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=-85.4573&amp;materialsCitation.latitude=10.9333" title="Search Plazi for locations around (long -85.4573/lat 10.9333)">Area de Conservacion Guanacaste</a>; verbatimLocality: Sendero Cima; verbatimElevation: 1460 m; verbatimLatitude: 10.9333; verbatimLongitude: -85.4573; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.9333; decimalLongitude: -85.4573; Identification: dateIdentified: 2014; Event: samplingProtocol: Malaise Trap; verbatimEventDate: 12/22/2008; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: PreservedSpecimen</p> <p>Type status: Paratype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu/caterpillars/database.lasso; catalogNumber: DHJPAR0031462; recordedBy: D.H.Janzen&amp;W.Hallwachs; individualID: DHJPAR0031462; individualCount: 1; sex: Male; lifeStage: adult; otherCatalogNumbers: 08-SRNP-38372; Taxon: scientificName: Venanusjohnnyrosalesi; phylum: Arthropoda; class: Insecta; order: Hymenoptera; family: Braconidae; genus: Venanus; specificEpithet: johnnyrosalesi; scientificNameAuthorship: Fernández-Triana; Location: continent: Central America; country: Costa Rica; stateProvince: Guanacaste; locality: <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=-85.4573&amp;materialsCitation.latitude=10.9333" title="Search Plazi for locations around (long -85.4573/lat 10.9333)">Area de Conservacion Guanacaste</a>; verbatimLocality: Sendero Cima; verbatimElevation: 1460 m; verbatimLatitude: 10.9333; verbatimLongitude: -85.4573; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.9333; decimalLongitude: -85.4573; Identification: dateIdentified: 2014; Event: samplingProtocol: Malaise Trap; verbatimEventDate: 12/22/2008; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: PreservedSpecimen</p> <p>Type status: Paratype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu/caterpillars/database.lasso; catalogNumber: DHJPAR0031466; recordedBy: D.H.Janzen&amp;W.Hallwachs; individualID: DHJPAR0031466; individualCount: 1; sex: Female; lifeStage: adult; otherCatalogNumbers: 08-SRNP-38376; Taxon: scientificName: Venanusjohnnyrosalesi; phylum: Arthropoda; class: Insecta; order: Hymenoptera; family: Braconidae; genus: Venanus; specificEpithet: johnnyrosalesi; scientificNameAuthorship: Fernández-Triana; Location: continent: Central America; country: Costa Rica; stateProvince: Guanacaste; locality: <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=-85.4573&amp;materialsCitation.latitude=10.9333" title="Search Plazi for locations around (long -85.4573/lat 10.9333)">Area de Conservacion Guanacaste</a>; verbatimLocality: Sendero Cima; verbatimElevation: 1460 m; verbatimLatitude: 10.9333; verbatimLongitude: -85.4573; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.9333; decimalLongitude: -85.4573; Identification: dateIdentified: 2014; Event: samplingProtocol: Malaise Trap; verbatimEventDate: 12/29/2008; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: PreservedSpecimen</p> <p>Type status: Paratype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu/caterpillars/database.lasso; catalogNumber: DHJPAR0031470; recordedBy: D.H.Janzen&amp;W.Hallwachs; individualID: DHJPAR0031470; individualCount: 1; sex: Male; lifeStage: adult; otherCatalogNumbers: 08-SRNP-38380; Taxon: scientificName: Venanusjohnnyrosalesi; phylum: Arthropoda; class: Insecta; order: Hymenoptera; family: Braconidae; genus: Venanus; specificEpithet: johnnyrosalesi; scientificNameAuthorship: Fernández-Triana; Location: continent: Central America; country: Costa Rica; stateProvince: Guanacaste; locality: <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=-85.4573&amp;materialsCitation.latitude=10.9333" title="Search Plazi for locations around (long -85.4573/lat 10.9333)">Area de Conservacion Guanacaste</a>; verbatimLocality: Sendero Cima; verbatimElevation: 1460 m; verbatimLatitude: 10.9333; verbatimLongitude: -85.4573; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.9333; decimalLongitude: -85.4573; Identification: dateIdentified: 2014; Event: samplingProtocol: Malaise Trap; verbatimEventDate: 01/05/2009; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: PreservedSpecimen</p> <p>Type status: Paratype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu/caterpillars/database.lasso; catalogNumber: DHJPAR0031472; recordedBy: D.H.Janzen&amp;W.Hallwachs; individualID: DHJPAR0031472; individualCount: 1; sex: Male; lifeStage: adult; otherCatalogNumbers: 08-SRNP-38382; Taxon: scientificName: Venanusjohnnyrosalesi; phylum: Arthropoda; class: Insecta; order: Hymenoptera; family: Braconidae; genus: Venanus; specificEpithet: johnnyrosalesi; scientificNameAuthorship: Fernández-Triana; Location: continent: Central America; country: Costa Rica; stateProvince: Guanacaste; locality: <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=-85.4573&amp;materialsCitation.latitude=10.9333" title="Search Plazi for locations around (long -85.4573/lat 10.9333)">Area de Conservacion Guanacaste</a>; verbatimLocality: Sendero Cima; verbatimElevation: 1460 m; verbatimLatitude: 10.9333; verbatimLongitude: -85.4573; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.9333; decimalLongitude: -85.4573; Identification: dateIdentified: 2014; Event: samplingProtocol: Malaise Trap; verbatimEventDate: 01/12/2009; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: PreservedSpecimen</p> <p>Type status: Paratype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu/caterpillars/database.lasso; catalogNumber: DHJPAR0031473; recordedBy: D.H.Janzen&amp;W.Hallwachs; individualID: DHJPAR0031473; individualCount: 1; sex: Male; lifeStage: adult; otherCatalogNumbers: 08-SRNP-38383; Taxon: scientificName: Venanusjohnnyrosalesi; phylum: Arthropoda; class: Insecta; order: Hymenoptera; family: Braconidae; genus: Venanus; specificEpithet: johnnyrosalesi; scientificNameAuthorship: Fernández-Triana; Location: continent: Central America; country: Costa Rica; stateProvince: Guanacaste; locality: <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=-85.4573&amp;materialsCitation.latitude=10.9333" title="Search Plazi for locations around (long -85.4573/lat 10.9333)">Area de Conservacion Guanacaste</a>; verbatimLocality: Sendero Cima; verbatimElevation: 1460 m; verbatimLatitude: 10.9333; verbatimLongitude: -85.4573; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.9333; decimalLongitude: -85.4573; Identification: dateIdentified: 2014; Event: samplingProtocol: Malaise Trap; verbatimEventDate: 01/12/2009; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: PreservedSpecimen</p> <p>Type status: Paratype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu/caterpillars/database.lasso; catalogNumber: DHJPAR0031480; recordedBy: D.H.Janzen&amp;W.Hallwachs; individualID: DHJPAR0031480; individualCount: 1; sex: Male; lifeStage: adult; otherCatalogNumbers: 08-SRNP-38390; Taxon: scientificName: Venanusjohnnyrosalesi; phylum: Arthropoda; class: Insecta; order: Hymenoptera; family: Braconidae; genus: Venanus; specificEpithet: johnnyrosalesi; scientificNameAuthorship: Fernández-Triana; Location: continent: Central America; country: Costa Rica; stateProvince: Guanacaste; locality: <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=-85.4573&amp;materialsCitation.latitude=10.9333" title="Search Plazi for locations around (long -85.4573/lat 10.9333)">Area de Conservacion Guanacaste</a>; verbatimLocality: Sendero Cima; verbatimElevation: 1460 m; verbatimLatitude: 10.9333; verbatimLongitude: -85.4573; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.9333; decimalLongitude: -85.4573; Identification: dateIdentified: 2014; Event: samplingProtocol: Malaise Trap; verbatimEventDate: 01/26/2009; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: PreservedSpecimen</p> <p>Type status: Paratype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu/caterpillars/database.lasso; catalogNumber: DHJPAR0031481; recordedBy: D.H.Janzen&amp;W.Hallwachs; individualID: DHJPAR0031481; individualCount: 1; sex: Male; lifeStage: adult; otherCatalogNumbers: 08-SRNP-38391; Taxon: scientificName: Venanusjohnnyrosalesi; phylum: Arthropoda; class: Insecta; order: Hymenoptera; family: Braconidae; genus: Venanus; specificEpithet: johnnyrosalesi; scientificNameAuthorship: Fernández-Triana; Location: continent: Central America; country: Costa Rica; stateProvince: Guanacaste; locality: <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=-85.4573&amp;materialsCitation.latitude=10.9333" title="Search Plazi for locations around (long -85.4573/lat 10.9333)">Area de Conservacion Guanacaste</a>; verbatimLocality: Sendero Cima; verbatimElevation: 1460 m; verbatimLatitude: 10.9333; verbatimLongitude: -85.4573; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.9333; decimalLongitude: -85.4573; Identification: dateIdentified: 2014; Event: samplingProtocol: Malaise Trap; verbatimEventDate: 02/02/2009; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: PreservedSpecimen</p> <p>Type status: Paratype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu/caterpillars/database.lasso; catalogNumber: DHJPAR0031486; recordedBy: D.H.Janzen&amp;W.Hallwachs; individualID: DHJPAR0031486; individualCount: 1; sex: Male; lifeStage: adult; otherCatalogNumbers: 08-SRNP-38396; Taxon: scientificName: Venanusjohnnyrosalesi; phylum: Arthropoda; class: Insecta; order: Hymenoptera; family: Braconidae; genus: Venanus; specificEpithet: johnnyrosalesi; scientificNameAuthorship: Fernández-Triana; Location: continent: Central America; country: Costa Rica; stateProvince: Guanacaste; locality: <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=-85.4573&amp;materialsCitation.latitude=10.9333" title="Search Plazi for locations around (long -85.4573/lat 10.9333)">Area de Conservacion Guanacaste</a>; verbatimLocality: Sendero Cima; verbatimElevation: 1460 m; verbatimLatitude: 10.9333; verbatimLongitude: -85.4573; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.9333; decimalLongitude: -85.4573; Identification: dateIdentified: 2014; Event: samplingProtocol: Malaise Trap; verbatimEventDate: 03/16/2009; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: PreservedSpecimen</p> <p>Type status: Paratype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu/caterpillars/database.lasso; catalogNumber: DHJPAR0031487; recordedBy: D.H.Janzen&amp;W.Hallwachs; individualID: DHJPAR0031487; individualCount: 1; sex: Male; lifeStage: adult; otherCatalogNumbers: 08-SRNP-38397; Taxon: scientificName: Venanusjohnnyrosalesi; phylum: Arthropoda; class: Insecta; order: Hymenoptera; family: Braconidae; genus: Venanus; specificEpithet: johnnyrosalesi; scientificNameAuthorship: Fernández-Triana; Location: continent: Central America; country: Costa Rica; stateProvince: Guanacaste; locality: <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=-85.4573&amp;materialsCitation.latitude=10.9333" title="Search Plazi for locations around (long -85.4573/lat 10.9333)">Area de Conservacion Guanacaste</a>; verbatimLocality: Sendero Cima; verbatimElevation: 1460 m; verbatimLatitude: 10.9333; verbatimLongitude: -85.4573; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.9333; decimalLongitude: -85.4573; Identification: dateIdentified: 2014; Event: samplingProtocol: Malaise Trap; verbatimEventDate: 03/16/2009; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: PreservedSpecimen</p> <p>Type status: Paratype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu/caterpillars/database.lasso; catalogNumber: DHJPAR0031489; recordedBy: D.H.Janzen&amp;W.Hallwachs; individualID: DHJPAR0031489; individualCount: 1; sex: Male; lifeStage: adult; otherCatalogNumbers: 08-SRNP-38399; Taxon: scientificName: Venanusjohnnyrosalesi; phylum: Arthropoda; class: Insecta; order: Hymenoptera; family: Braconidae; genus: Venanus; specificEpithet: johnnyrosalesi; scientificNameAuthorship: Fernández-Triana; Location: continent: Central America; country: Costa Rica; stateProvince: Guanacaste; locality: <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=-85.4573&amp;materialsCitation.latitude=10.9333" title="Search Plazi for locations around (long -85.4573/lat 10.9333)">Area de Conservacion Guanacaste</a>; verbatimLocality: Sendero Cima; verbatimElevation: 1460 m; verbatimLatitude: 10.9333; verbatimLongitude: -85.4573; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.9333; decimalLongitude: -85.4573; Identification: dateIdentified: 2014; Event: samplingProtocol: Malaise Trap; verbatimEventDate: 03/23/2009; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: PreservedSpecimen</p> <p>Type status: Paratype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu/caterpillars/database.lasso; catalogNumber: DHJPAR0031491; recordedBy: D.H.Janzen&amp;W.Hallwachs; individualID: DHJPAR0031491; individualCount: 1; sex: Male; lifeStage: adult; otherCatalogNumbers: 08-SRNP-38401; Taxon: scientificName: Venanusjohnnyrosalesi; phylum: Arthropoda; class: Insecta; order: Hymenoptera; family: Braconidae; genus: Venanus; specificEpithet: johnnyrosalesi; scientificNameAuthorship: Fernández-Triana; Location: continent: Central America; country: Costa Rica; stateProvince: Guanacaste; locality: <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=-85.4573&amp;materialsCitation.latitude=10.9333" title="Search Plazi for locations around (long -85.4573/lat 10.9333)">Area de Conservacion Guanacaste</a>; verbatimLocality: Sendero Cima; verbatimElevation: 1460 m; verbatimLatitude: 10.9333; verbatimLongitude: -85.4573; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.9333; decimalLongitude: -85.4573; Identification: dateIdentified: 2014; Event: samplingProtocol: Malaise Trap; verbatimEventDate: 03/23/2009; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: PreservedSpecimen</p> <p>Type status: Paratype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu/caterpillars/database.lasso; catalogNumber: DHJPAR0031493; recordedBy: D.H.Janzen&amp;W.Hallwachs; individualID: DHJPAR0031493; individualCount: 1; sex: Male; lifeStage: adult; otherCatalogNumbers: 08-SRNP-38403; Taxon: scientificName: Venanusjohnnyrosalesi; phylum: Arthropoda; class: Insecta; order: Hymenoptera; family: Braconidae; genus: Venanus; specificEpithet: johnnyrosalesi; scientificNameAuthorship: Fernández-Triana; Location: continent: Central America; country: Costa Rica; stateProvince: Guanacaste; locality: <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=-85.4573&amp;materialsCitation.latitude=10.9333" title="Search Plazi for locations around (long -85.4573/lat 10.9333)">Area de Conservacion Guanacaste</a>; verbatimLocality: Sendero Cima; verbatimElevation: 1460 m; verbatimLatitude: 10.9333; verbatimLongitude: -85.4573; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.9333; decimalLongitude: -85.4573; Identification: dateIdentified: 2014; Event: samplingProtocol: Malaise Trap; verbatimEventDate: 03/30/2009; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: PreservedSpecimen</p> <p>Type status: Paratype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu/caterpillars/database.lasso; catalogNumber: DHJPAR0031494; recordedBy: D.H.Janzen&amp;W.Hallwachs; individualID: DHJPAR0031494; individualCount: 1; sex: Male; lifeStage: adult; otherCatalogNumbers: 08-SRNP-38404; Taxon: scientificName: Venanusjohnnyrosalesi; phylum: Arthropoda; class: Insecta; order: Hymenoptera; family: Braconidae; genus: Venanus; specificEpithet: johnnyrosalesi; scientificNameAuthorship: Fernández-Triana; Location: continent: Central America; country: Costa Rica; stateProvince: Guanacaste; locality: <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=-85.4573&amp;materialsCitation.latitude=10.9333" title="Search Plazi for locations around (long -85.4573/lat 10.9333)">Area de Conservacion Guanacaste</a>; verbatimLocality: Sendero Cima; verbatimElevation: 1460 m; verbatimLatitude: 10.9333; verbatimLongitude: -85.4573; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.9333; decimalLongitude: -85.4573; Identification: dateIdentified: 2014; Event: samplingProtocol: Malaise Trap; verbatimEventDate: 03/30/2009; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: PreservedSpecimen</p> <p>Type status: Paratype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu/caterpillars/database.lasso; catalogNumber: DHJPAR0031497; recordedBy: D.H.Janzen&amp;W.Hallwachs; individualID: DHJPAR0031497; individualCount: 1; sex: Male; lifeStage: adult; otherCatalogNumbers: 08-SRNP-38407; Taxon: scientificName: Venanusjohnnyrosalesi; phylum: Arthropoda; class: Insecta; order: Hymenoptera; family: Braconidae; genus: Venanus; specificEpithet: johnnyrosalesi; scientificNameAuthorship: Fernández-Triana; Location: continent: Central America; country: Costa Rica; stateProvince: Guanacaste; locality: <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=-85.4573&amp;materialsCitation.latitude=10.9333" title="Search Plazi for locations around (long -85.4573/lat 10.9333)">Area de Conservacion Guanacaste</a>; verbatimLocality: Sendero Cima; verbatimElevation: 1460 m; verbatimLatitude: 10.9333; verbatimLongitude: -85.4573; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.9333; decimalLongitude: -85.4573; Identification: dateIdentified: 2014; Event: samplingProtocol: Malaise Trap; verbatimEventDate: 03/02/2009; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: PreservedSpecimen</p> <p>Type status: Paratype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu/caterpillars/database.lasso; catalogNumber: DHJPAR0031498; recordedBy: D.H.Janzen&amp;W.Hallwachs; individualID: DHJPAR0031498; individualCount: 1; sex: Male; lifeStage: adult; otherCatalogNumbers: 08-SRNP-38408; Taxon: scientificName: Venanusjohnnyrosalesi; phylum: Arthropoda; class: Insecta; order: Hymenoptera; family: Braconidae; genus: Venanus; specificEpithet: johnnyrosalesi; scientificNameAuthorship: Fernández-Triana; Location: continent: Central America; country: Costa Rica; stateProvince: Guanacaste; locality: <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=-85.4573&amp;materialsCitation.latitude=10.9333" title="Search Plazi for locations around (long -85.4573/lat 10.9333)">Area de Conservacion Guanacaste</a>; verbatimLocality: Sendero Cima; verbatimElevation: 1460 m; verbatimLatitude: 10.9333; verbatimLongitude: -85.4573; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.9333; decimalLongitude: -85.4573; Identification: dateIdentified: 2014; Event: samplingProtocol: Malaise Trap; verbatimEventDate: 03/02/2009; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: PreservedSpecimen</p> <p>Type status: Paratype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu/caterpillars/database.lasso; catalogNumber: DHJPAR0031499; recordedBy: D.H.Janzen&amp;W.Hallwachs; individualID: DHJPAR0031499; individualCount: 1; sex: Male; lifeStage: adult; otherCatalogNumbers: 08-SRNP-38409; Taxon: scientificName: Venanusjohnnyrosalesi; phylum: Arthropoda; class: Insecta; order: Hymenoptera; family: Braconidae; genus: Venanus; specificEpithet: johnnyrosalesi; scientificNameAuthorship: Fernández-Triana; Location: continent: Central America; country: Costa Rica; stateProvince: Guanacaste; locality: <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=-85.4573&amp;materialsCitation.latitude=10.9333" title="Search Plazi for locations around (long -85.4573/lat 10.9333)">Area de Conservacion Guanacaste</a>; verbatimLocality: Sendero Cima; verbatimElevation: 1460 m; verbatimLatitude: 10.9333; verbatimLongitude: -85.4573; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.9333; decimalLongitude: -85.4573; Identification: dateIdentified: 2014; Event: samplingProtocol: Malaise Trap; verbatimEventDate: 04/06/2009; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: PreservedSpecimen</p> <p>Description</p> <p>Female. Body length: 2.3 mm. Fore wing length: 2.2 mm. Flagellomere 2 length/width: 0.11 mm/0.05 mm. Flagellomere 14 length/width: 0.08 mm/0.06 mm. Oculo-ocellar distance: 0.14 mm. Distance between posterior ocelli: 0.08 mm. Diameter of posterior ocellus: 0.05 mm. Metafemur length/width: 0.52 mm/0.20 mm. Metatibia length: 0.62 mm. Mediotergite 1 length/maximum width/minimum width: 0.30/0.15/0.08 mm. Mediotergite 2 length/width at posterior margin: 0.13/0.08 mm. Figs 1, 2.</p> <p>Male: As female, but metafemur thinner and antenna longer.</p> <p>Diagnosis</p> <p>The mediotergite 1 is relatively long and with a slight constriction near anterior end (Fig. 2). That character is also shared with other three species of Venanus. However, V. johnnyrosalesi can be separated from V. helavai by its much smaller size (2.3 mm vs 2.8-3.0 mm) and less sculptured propodeum, from V. yanayacuensis by its wider discal cell in fore wing (1.0 × vs 1.2 × as wide as high), metasoma color (brown vs black) and fore wing vein 2RS significanly longer than vein r (shorter than r in yanayacuensis), and from V. randallgarciai by proportion of veins 2RS and r (1.4 × vs 2.0 ×), sculpture of metapleuron and mediotergite 2, and less narrow mediotergite 1 (narrowest width 0.8 × width at posterior margin vs 0.6 × in randallgarciai).</p> <p>Etymology</p> <p>Venanus johnnyrosalesi is named in honor of Sr. Johnny Rosales, currently of San Jose, Costa Rica, but also a major user, appreciator and former director of ACG.</p> <p>Distribution</p> <p>Only know from Volcán Cacao, ACG, Costa Rica.</p> <p>Notes</p> <p>A total of 60 specimens (some of them not examined for this paper) were sampled for DNA, and 50 rendered full barcode sequences of 658 base pairs (see also Suppl. material 1). These sequences were characterised by very limited variation (a single synonymous, third base G/A transition). The holotype specimen (DHJPAR0031445) has the sequence accession ASHYG706-10 in BOLD (www.boldsystems.org) and the nucleotide sequence is reproduced below:</p> <p>AATATTATACTTTATTTTTGGGTTATGAGCTGGTATAGTAGGATTTTCTATAAGAATAATCATTCGCTTAGAATTAGGAATACCTGGAAATTTAATTGGAAATGACCAAATTTATAATAGAATTGTTACTTCTCATGCTTTTATTATAATTTTTTTCATAGTTATACCAATCATAATTGGTGGATTTGGTAACTGATTAATTCCTTTAATATTAGGTACTCCAGATATAGCATTCCCTCGAATAAATAATATAAGATTTTGGTTACTTCTACCTTCATTATTTTTATTAATTTTAAGTAGATTTATTAATACAGGGGTAGGAACGGGATGAACAGTATACCCTCCTTTGTCATTAATTTTAGGCCATGGGGGAATATCAGTAGACCTGGGTATTTTTTCTCTTCATTTAGCAGGAATATCTTCAATTATAGGGGCTATTAATTTTATTTCCACAATTATAAATATACGAACAAATTTTTTAATAATAGACAAAATCTCTTTATTTTCATGATCTGTTTTAATTACAGCTATTTTATTACTTCTATCTTTACCAGTTTTAGCTGGAGCAATTACTATACTACTGACAGATCGAAATTTAAATACAAGATTTTTTGATCCAAGTGGAGGTGGAGATCCAATTCTTTATCAACATTTATTT</p></div> 	https://treatment.plazi.org/id/D080BF726518ED82EE1A0AA5347108E9	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Fernandez-Triana, Jose L;Whitfield, James B;Smith, M. Alex;Hallwachs, Winnie;Janzen, Daniel H.	Fernandez-Triana, Jose L, Whitfield, James B, Smith, M. Alex, Hallwachs, Winnie, Janzen, Daniel H. (2014): First record of the genus Venanus (Hymenoptera: Braconidae: Microgastrinae) in Mesoamerica, with the description of two new species from Costa Rica. Biodiversity Data Journal 2: 4167, DOI: http://dx.doi.org/10.3897/BDJ.2.e4167, URL: http://dx.doi.org/10.3897/BDJ.2.e4167
CD3489B3C69CCEE5015B7C4AD096BDE4.text	CD3489B3C69CCEE5015B7C4AD096BDE4.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Venanus Mason 1981	<div><p>Venanus Mason, 1981</p> <p>Venanus Mason, 1981: 94.</p> <p>Diagnosis</p> <p>The genus Venanus can be recognized by the following combination of features: Body shape shape relatively slender, often somewhat dorsoventrally flattened. Body color typically black nearly throughout, legs variable in color. Fore wing with closed areolet (r-m present). Metacoxae relatively small (as in Microplitis). Propodeum rugose, with medial carina present, at least for some portion of length. First metasomal tergite relatively elongate, of somewhat variable shape and degree of sculpturing. Second metasomal tergum with median raised area that is narrower than first tergite, at least at their junction. Ovipositor sheath distally with setae highly reduced in size (as in Distatrix, and Venanides). The genus is restricted to the New World, from as north as Canada (Yukon Territory) to Chile in South America (Mason 1981, Fernandez-Triana 2010, Whitfield et al. 2011). It is a relatively small genus, with nine species previoulsy described and a few other apparent new species found in collections (Whitfield et al. 2011). Leafmining and needle mining caterpillars were believed to be the main hosts (Mason 1981), however recently collecting and rearing of caterpiilas in South America suggests that other hosts such as Pyralidae might also be common (Whitfield et al. 2011).</p> </div>	https://treatment.plazi.org/id/CD3489B3C69CCEE5015B7C4AD096BDE4	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Fernandez-Triana, Jose L;Whitfield, James B;Smith, M. Alex;Hallwachs, Winnie;Janzen, Daniel H.	Fernandez-Triana, Jose L, Whitfield, James B, Smith, M. Alex, Hallwachs, Winnie, Janzen, Daniel H. (2014): First record of the genus Venanus (Hymenoptera: Braconidae: Microgastrinae) in Mesoamerica, with the description of two new species from Costa Rica. Biodiversity Data Journal 2: 4167, DOI: http://dx.doi.org/10.3897/BDJ.2.e4167, URL: http://dx.doi.org/10.3897/BDJ.2.e4167
4AE9E3C0315606AB7DDF0CD90D856283.text	4AE9E3C0315606AB7DDF0CD90D856283.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Venanus randallgarciai Fernandez-Triana & Whitfield	<div><p>Venanus randallgarciai Fernandez-Triana &amp; Whitfield sp. n.</p> <p>Materials</p> <p>Type status: Holotype. Occurrence: catalogNumber: CNCHYM 07223; recordedBy: J. Helava; individualID: CNCHYM 07223; individualCount: 1; sex: female; lifeStage: adult; Taxon: scientificName: Venanusrandallgarciai; phylum: Arthropoda; class: Insecta; order: Hymenoptera; family: Braconidae; genus: Venanus; specificEpithet: randallgarciai; scientificNameAuthorship: Fernández-Triana; Location: continent: Central America; country: Costa Rica; stateProvince: Alajuela; locality: <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=-84.166664&amp;materialsCitation.latitude=10.283334" title="Search Plazi for locations around (long -84.166664/lat 10.283334)">500 m North of Colonia Virgen del Socorro, Area de Conservacion Cordillera Volcanica Central</a>; verbatimElevation: 1400 m; verbatimLatitude: 10° 17' N; verbatimLongitude: 84° 10' W; verbatimCoordinateSystem: Degree, minutes; Identification: dateIdentified: 2014; Event: verbatimEventDate: 30-v-1973; Record Level: language: en; collectionCode: Insects; ownerInstitutionCode: CNC; basisOfRecord: PreservedSpecimen</p> <p>Description</p> <p>Female. Body length: 2.2 mm. Fore wing length: 2.2 mm. Flagellomere 2 length/width: 0.11 mm/0.06 mm. Flagellomere 14: missing. Oculo-ocellar distance: 0.15 mm. Distance between posterior ocelli: 0.08 mm. Diameter of posterior ocellus: 0.05 mm. Metafemur length/width: 0.53 mm/0.18 mm. Metatibia length: 0.66 mm. Mediotergite 1 length/maximum width/minimum width: 0.30/0.15/0.09 mm. Mediotergite 2 length/width at posterior margin: 0.12/0.10 mm. Figs 3, 4.</p> <p>Male. Unknown.</p> <p>Diagnosis</p> <p>The mediotergite 1 is relatively long and with a slight constriction near anterior end (Fig. 4). That character is also shared with other three species of Venanus. However, V. johnnyrosalesi can be separated from V. helavai by its much smaller size (2.2 mm vs 2.8-3.0 mm) and less sculptured propodeum, from V. yanayacuensis by its wider discal cell in fore wing (1.0 × vs 1.2 × as wide as high), metasoma color (brown vs black) and fore wing vein 2RS significanly longer than vein r (shorter than r in yanayacuensis), and from V. johnnyrosalesi by proportion of veins 2RS and r (2.0 × vs 1.4 ×), sculpture of metapleuron and mediotergite 2, and narrower mediotergite 1 (narrowest width 0.6 × width at posterior margin vs 0.8 × in johnnyrosalesi).</p> <p>Etymology</p> <p>Venanus randallgarciai is named in honor of Sr. Randall Garcia, currently of San Jose, Costa Rica, but also the first director of ACG and the current Executive Director of the Instituto Nacional de Biodiversidad (INBio), and therefore a major facilitator of ACG biodiversity inventory.</p> <p>Distribution</p> <p>Only known from a single locality in Area de Conservación Cordillera Volcanica Central, Alajuela, Costa Rica.</p> <p>Notes</p> <p>We obtained a partial sequence (164 bp) of the DNA barcoding region for the holotype (see also Suppl. material 1). It has the sequence accesion HYCNF533-11 in BOLD (www.boldsystems.org), and the nucleotide sequence is reproduced below:</p> <p>TTATACCAATTATAATTGGAGGATTTGGAAATTGATTGGTGCCATTAATATTAGGGACTCCAGATATAGCTTTCCCTCGTATAAATAATATAAGATTTTGATTACTTATTCCTTCATTAT TTATATTAATTTTAAGAAGATTCATTAATACAGGCGCAGGTACG</p></div> 	https://treatment.plazi.org/id/4AE9E3C0315606AB7DDF0CD90D856283	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Fernandez-Triana, Jose L;Whitfield, James B;Smith, M. Alex;Hallwachs, Winnie;Janzen, Daniel H.	Fernandez-Triana, Jose L, Whitfield, James B, Smith, M. Alex, Hallwachs, Winnie, Janzen, Daniel H. (2014): First record of the genus Venanus (Hymenoptera: Braconidae: Microgastrinae) in Mesoamerica, with the description of two new species from Costa Rica. Biodiversity Data Journal 2: 4167, DOI: http://dx.doi.org/10.3897/BDJ.2.e4167, URL: http://dx.doi.org/10.3897/BDJ.2.e4167
