identifier	taxonID	type	CVterm	format	language	title	description	additionalInformationURL	UsageTerms	rights	Owner	contributor	creator	bibliographicCitation
885CEF51D73F5A8CA89219CB20107831.text	885CEF51D73F5A8CA89219CB20107831.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Rogas Nees 1818	<div><p>Genus  Rogas Nees, 1818</p><p>Rogas Nees, 1818: 306 (type species: (designated by Curtis 1834):  Ichneumon testaceus Fabricius, 1798 [nec  I. testaceus Gmelin, 1790; =  Rogas luteus Nees, 1834]).</p><p>Pelecystoma Wesmael, 1838: 91; Shenefelt 1975: 1206–1209; Tobias 1976: 89; Marsh 1979 a: 178; Tobias 1986: 84–85 (included in 
Rogas
auct). Syn. by van Achterberg 1982. Type species (designated by Foerster 1862): 
Rogas luteus Nees, 1834
[type lost]. Synonymy.</p><p>Rhogas Agassiz, 1846: 325 (invalid emendation).</p><p>Diagnosis.</p><p>Antenna with more than 50 flagellomeres. Maxillary palpus segment 3 strongly enlarged and laterally flattened in both sexes (Fig. 1 D, F), segment 4 distinctly expanded basally. Labial palpus segment 2 inflated. Propodeum with short mid-longitudinal carina medioanteriorly which divides to form a pair of near parallel submedial carinae. Hind wing veins 1 rs-m and M joining at an acute angle, much less than 75 °. Hind wing vein M 1.15–1.5 × longer than M + CU. Hind tibia with comb of modified setae distomedially (Fig. 2 B). Hind tibial spurs straight and evenly setose. Tarsal claws with large, dark, rather square basal lobe. Metasomal tergite 1 approximately 1.2 × longer than posteriorly wide. Dorsope present, large and deep; dorsal carinae of metasomal tergite 1 remaining separate or joined to form point (Fig. 2 E). Metasomal tergite 2 with wide polygonal midbasal area (Fig. 2 F); midlongitudinal carina variably present. Metasomal tergites 2–5 with sharp lateral crease. Female hypopygium ventrally nearly straight and posteriorly truncate.</p><p>Rogas was redescribed and illustrated by van Achterberg (1991), reproduced and slightly modified by Chen and He (1997), and the holotype of  Rogas luteus was illustrated by van Achterberg (1991). Chen and He (1997) provide a key to Old World species.</p><p>Rogas may be distinguished from both Old and New World  Triraphis by its maxillary palpi having the third segment swollen and laterally flattened having the swollen third segment (Fig. 1 D, F), the occipital carina being complete (although sometimes weak) ventrally and joining hypostomal carina (reduced ventrally, without ventral junction with hypostomal carina in  Triraphis) (Fig. 1 C) (Ratnasingham and Hebert 2013), and with claws which have a large, dark square (truncate) basal lobe (small, acute and pale in  Triraphis) (Fig. 2 C) (van Achterberg 1991; Chen and He 1997).</p><p>All reliable host records for  Rogas are from  Limacodidae caterpillars (Quicke and Shaw 2006). Published records from  Zygaenidae result from failure to recognize  Triraphis as a distinct genus (Quicke et al. 2003) and records from other families might result from misidentifications of  Aleiodes species.</p></div>	https://treatment.plazi.org/id/885CEF51D73F5A8CA89219CB20107831	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Quicke, Donald L. J.;Sharkey, Michael J.;Janzen, Daniel H.;Hallwachs, Winnie;Butcher, Buntika A.	Quicke, Donald L. J., Sharkey, Michael J., Janzen, Daniel H., Hallwachs, Winnie, Butcher, Buntika A. (2025): Discovery of the Old World genus Rogas Nees (Hymenoptera, Braconidae, Rogadinae) in the New World by DNA barcoding. Deutsche Entomologische Zeitschrift 72 (1): 1-7, DOI: 10.3897/dez.72.142960
B8A153B6B63F5A5B96974376DF9D31A3.text	B8A153B6B63F5A5B96974376DF9D31A3.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Rogas shimborii Quicke & Sharkey 2025	<div><p>Rogas shimborii Quicke &amp; Sharkey sp. nov.</p><p>Type material.</p><p>Holotype. Costa Rica • ♀; Area de Conservación Guanacaste, Guanacaste Province, Sector Pailas, <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=-85.334&amp;materialsCitation.latitude=10.76" title="Search Plazi for locations around (long -85.334/lat 10.76)">Pailas Dos</a>, 10.76 ° N, 85.334 ° W, 809 m, 2. viii. 2018, leg. D. Janzen, W. Hallwachs, ecotone between lowland tropical dry forest and intermediate elevation rain forest, Malaise trap PL 12-9); CNC (Specimen voucher: BIOUG 58035-F 04; BIN BOLD: AEF 7075)  .   Paratype: Costa Rica • 1 ♀; Area de Conservación Guanacaste, Guanacaste Province, Sector Pailas, <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=-85.333&amp;materialsCitation.latitude=10.764" title="Search Plazi for locations around (long -85.333/lat 10.764)">Pailas Dos</a>, 10.764 ° N, 85.333 ° W, 853 m, 25. vi. 2020, leg. D. Janzen, W. Hallwachs, ecotone between lowland tropical dry forest and intermediate elevation rain forest, Malaise trap (PL 12-6); CNC. (Specimen voucher: BIOUG 63902-A 02; BIN BOLD: AEF 707)  .</p><p>Diagnostics.</p><p>BOLD: AEF 7075. Consensus barcode: TTTATATTTTTTATTTGGTATTTGAGCGGGGCTTTTAGGGCTATCTATAAGGTTAATTATTCGGTTAGAATTAAGTATACCTGGGAGGTTATTAGGTAATGATCAGATTTATAATGGAATAGTAACTGCACATGCATTTATCATAATTTTTTTTATAGTAATACCTATTATAATTGGGGGGTTTGGTAATTGATTAATTCCTTTAATATTAGGGGCTCCTGATATGGCTTTCCCTCGTATAAATAATATAAGATTTTGATTGTTAATTCCGTCATTAATTTTATTATTATTAAGAGCTATTGTAAATGTAGGGGTTGGTACAGGTTGAACAATTTATCCTCCTTTATCTTCTTTAATAGGGCATGGAGGGATATCTGTTGATTTAGCTATTTTTTCTTTACATTTAGCAGGTATCTCTTCTATTATAGGGGTTGTAAATTTTATTTCTACAATTTTTAATATAAAGTTAATTTCTATTAGTCTAGATCAGATTAATTTATTTGTATGGTCTGTTTTAATTACTGCTATTTTATTATTATTATCTTTACCTGTATTAGCGGGGGCCATTACAATATTATTAACAGATCGTAATTTAAATACAACTTTTTTTGATTTTTCAGGGGGGGGGGATCCTGTTTTATTTCAACATTTATTT</p><p>The new species may be distinguished from all other described species by its bicolorous (black and ivory-white metasoma (Fig. 1 A, B); these are reddish-yellow, ochreous-yellow or brown in  R. luteus,  R. oyeyamensis (Watanabe, 1937),  R. roxana (Telenga, 1941),  R. nigrovenosus (Vojnovskaja-Krieger, 1935),  R. nigristigma Chen &amp; He, and  R. flavus Chen &amp; He, 1997 largely uniformly black in  R. nigricans Chen &amp; He, 1997, and  R. nigridorsum Belokobylskij, 1996 . The infuscate median transverse band of the forewing (Fig. 2 A) is also unique to this species.</p><p>Etymology.</p><p>Named in honor of Eduardo Mitio Shimbori in recognition of his contributions to Neotropical  Rogadinae systematics.</p><p>Molecular results</p><p>Analysis of the concatenated two gene data set recovers the new species nested within the Old World  Rogas representatives, and as sister group to  R. roxana from the Russian Far East, though with low support (Fig. 3), and far removed from  Triraphis . However, the latter genus was not recovered as monophyletic and its two clades were well separated. The larger clade was entirely comprised of Meso- and South American species whereas the smaller clade largely contained Old World species but also including  T. discoideus (Cresson, 1869) from North America and one species,  T. robertomirandai Sharkey, 2021, from Costa Rica.</p></div>	https://treatment.plazi.org/id/B8A153B6B63F5A5B96974376DF9D31A3	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Quicke, Donald L. J.;Sharkey, Michael J.;Janzen, Daniel H.;Hallwachs, Winnie;Butcher, Buntika A.	Quicke, Donald L. J., Sharkey, Michael J., Janzen, Daniel H., Hallwachs, Winnie, Butcher, Buntika A. (2025): Discovery of the Old World genus Rogas Nees (Hymenoptera, Braconidae, Rogadinae) in the New World by DNA barcoding. Deutsche Entomologische Zeitschrift 72 (1): 1-7, DOI: 10.3897/dez.72.142960
