identifier	taxonID	type	CVterm	format	language	title	description	additionalInformationURL	UsageTerms	rights	Owner	contributor	creator	bibliographicCitation
C45B002EFFEAFF88E22FAE76732D31EB.text	C45B002EFFEAFF88E22FAE76732D31EB.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	(Hyalaus) Zhang & Cong & Shen & Song & Grishin 2024	<div><p>Hyalaus Grishin, new subgenus</p><p>http://zoobank.org/ 3F5F76FC-9BDA-48A2-A6C2-53C0C2E49C2D</p><p>Type species. Papilio epidaus E. Doubleday, 1846 .</p><p>Definition. Genomic phylogeny that includes type species of all available genus-group names in Eurytides Hübner, [1821] (type species Eurytides iphitas Hübner, [1821]) reveals a lineage consisting of Eurytides epidaus (E. Doubleday, 1846) (type locality in Mexico (Yucatan) and Honduras) (Fig. 1 magenta) that is sister to the subgenus Mimoides K. Brown, 1991 (type species Papilio ariarathes Esper, 1788). The subgenus Boreographium Grishin, 2021 (type species Papilio marcellus Cramer, 1777) is sister to both Mimoides and the lineage with E. epidaus . To keep the classification monophyletic, this Mimoides, or a new subgenus should be erected for it. Mimoides, as originally circumscribed, includes species unified by certain recognizable appearance,</p><p>and E. epidaus does not resemble this phenotype,</p><p>having a different look (Fig. 2) more similar to</p><p>Protesilaus W. Swainson, 1832 (type species</p><p>Papilio protesilaus Linnaeus, 1758). Moreover,</p><p>Mimoides is a genetically compact group (Fig. 1),</p><p>and E. epidaus is separated from Mimoides by a prominent tree branch. The COI barcode difference between E. epidaus and E. ariarathes (the type species of Mimoides) is 6.8% (45 bp), which is not atypical for species in different subgenera. For all these reasons, we propose to treat the lineage with</p><p>E. epidaus as a new subgenus. This new subgenus differs from others by the presence of a hyaline area on the forewing distad of the postdiscal discal dark band; more produced, rounder forewing apex similar in shape to that of Mimoides; harpe with hookshaped process in the middle directed anteroventrad, also present in Boreographium but absent in others, e.g., in Mimoides, and differs from Boreographium by a broader dorsal keel and excavate distal margin. In DNA, a combination of the following characters is diagnostic in the nuclear genome: pgl8036.1.5:T51A, pgl231.44.1:G809A, pgl231.44.1:T816C, pgl 2266.11.4:T147C, pgl3034.5.5:T39A and in COI barcode: T133A, A352C, T364A, T454A, A541T. Etymology. In Greek, hyalos (ὕαλος) means glass; named for the glassy (i.e., hyaline) areas on forewings of the type species. The name is a masculine noun in the nominative singular.</p><p>Species included. Only the type species (i.e., Papilio epidaus E. Doubleday, 1846).</p><p>Parent taxon. Genus Eurytides Hübner, [1821] .</p><p>Comment. As a result, we partitioned the genus Eurytides into six subgenera: Mimoides, Hyalaus subgen. n., Boreographium, Neographium Möhn, 2002 (type species Papilio philolaus Boisduval, 1836), Eurytides, and Protesilaus W. Swainson, 1832 (Fig. 1).</p></div>	https://treatment.plazi.org/id/C45B002EFFEAFF88E22FAE76732D31EB	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFEBFF88E21CAF12753933C5.text	C45B002EFFEBFF88E21CAF12753933C5.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Eurema ella (Rober 1909) Zhang & Cong & Shen & Song & Grishin 2024	<div><p>Eurema ella (Röber, 1909) is a species distinct from Eurema elathea (Cramer, 1777)</p><p>Genomic phylogeny of all known species of Eurema Hübner, [1819] (type species Papilio delia Cramer, 1780, a primary junior homonym, valid name for this species is Pieris daira Godart, 1819) sensu stricto reveals that Eurema elathea ella (Röber, 1909) (type locality in Ecuador) (Fig. 3 orange) is not monophyletic with Eurema elathea (Cramer, 1777) (type locality in “Virginia”, possibly Haiti) (Fig. 3 green) and is closer related to several species that include Eurema daira (Godart, 1819) (type locality in USA: Virginia) (Fig. 3 purple), but genetically differentiated from them. Therefore, we propose that Eurema ella (Röber, 1909), stat. nov. is a species distinct from Eurema elathea (Cramer, 1777) .</p></div>	https://treatment.plazi.org/id/C45B002EFFEBFF88E21CAF12753933C5	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFEBFF8BE1B5AD6B747B316E.text	C45B002EFFEBFF8BE1B5AD6B747B316E.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Eurema flavescens (Chavannes 1850)	<div><p>Eurema flavescens (Chavannes, 1850) is a species distinct from Eurema elathea (Cramer, 1777)</p><p>Genomic analysis reveals that Terias flavescens Chavannes, 1850 (type locality in Brazil: São Paulo) (Fig. 3 magenta), currently regarded as a subspecies of Eurema elathea (Cramer, 1777) (type locality in “Virginia”, possibly Haiti) (Fig. 3 green) is genetically differentiated from it at the species level, e.g., their COI barcodes differ by 2.9% (19 bp). Therefore, we propose that Eurema flavescens (Chavannes, 1850), stat. rest. is a species distinct from Eurema elathea (Cramer, 1777) . Out of all other subspecies of E. elathea, Terias elathea obsoleta Jörgensen, 1932 (type locality in Paraguay) is closely related to E. flavescens, while others remain with E. elathea (Fig. 3). Thus, we additionally propose a new species-subspecies combination Eurema flavescens obsoleta (Jörgensen, 1932) .</p></div>	https://treatment.plazi.org/id/C45B002EFFEBFF8BE1B5AD6B747B316E	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFE8FF8AE0A6ACFB723935E1.text	C45B002EFFE8FF8AE0A6ACFB723935E1.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Eugrumia Della Bruna, Gallo, Lucarelli & Sbordoni 2000	<div><p>Eugrumia Della Bruna, Gallo, Lucarelli &amp; Sbordoni, 2000 is a valid genus, and Sinerebia Nakatani, 2017 is its junior subjective synonym</p><p>Correcting a nomenclatural mistake in Zhang et al. (2023d), we state that Sinerebia Nakatani, 2017, syn. nov. (type species Erebia atramentaria Bang-Haas, 1927) is a junior subjective synonym of Eugrumia Della Bruna, Gallo, Lucarelli &amp; Sbordoni, 2000 (type species Erebia herse Grum-Grshimaïlo, 1891), which is a valid genus. These two names were erroneously swapped in Zhang et al. (2023d), and this mistake is corrected here to follow the priority of the two names (2000 vs. 2017). The arguments for the in Sinerebia and Eugrumia are the same as those discussed previously (Zhang et al. 2023d). As a result, we have Eugrumia atramentaria (Bang-Haas, 1927), comb. nov. We are grateful to Gian C. Bozano for kindly informing us about this error.</p></div>	https://treatment.plazi.org/id/C45B002EFFE8FF8AE0A6ACFB723935E1	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFE8FF8BE19EAEDE75A83308.text	C45B002EFFE8FF8BE19EAEDE75A83308.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Eurema millerorum (Llorente & Luis 1987) Llorente & Luis 1987	<div><p>Eurema millerorum Llorente &amp; Luis, 1987 is a species distinct from Eurema agave (Cramer, 1775)</p><p>Genomic sequencing reveals that Eurema agave millerorum Llorente &amp; Luis, 1987 (type locality in Mexico: Tabasco) (Fig. 3 red) is genetically differentiated from Eurema agave (Cramer, [1775]) (type locality in Suriname) (Fig. 3 blue) at the species level, e.g., their COI barcodes differ by 3.2% (21 bp). Therefore, we propose that Eurema millerorum Llorente &amp; Luis, 1987, stat. nov. is a species distinct from Eurema agave (Cramer, 1775) . Due to comparatively smaller genetic differentiation in the nuclear genome (Fig. 3a), we leave Terias pallida Chavannes, 1850 (type locality in Brazil: São Paulo) as a subspecies of E. agave but note its distinct mitochondrial genome (Fig. 3b) needing further investigation.</p></div>	https://treatment.plazi.org/id/C45B002EFFE8FF8BE19EAEDE75A83308	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFE9FF85E1A2AB41741B3660.text	C45B002EFFE9FF85E1A2AB41741B3660.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Microtia elva subsp. bogotana Zhang & Cong & Shen & Song & Grishin 2024	<div><p>Microtia elva bogotana Grishin, new subspecies</p><p>http://zoobank.org/ 89EA04FE-2674-42EA-9B2E-AE4752B17097</p><p>(Figs. 4 part, 5)</p><p>Definition and diagnosis. Genomic analysis of Microtia elva H. Bates, 1864 (type locality in Guatemala and Nicaragua) reveals that while more boldly patterned southern populations included in the subspecies Microtia elva horni Rebel, 1906 (type locality in Mexico: Oaxaca) (Fig. 4 labeled in cyan) are not phylogenetically separated from the nominotypical subspecies (Fig. 4 labeled in blue), the two specimens from Bogota in Colombia, which corresponds to the southernmost known record of the species, are genetically differentiated from the rest (Fig. 4 magenta) and we consider them to represent a new subspecies of M. elva . This new subspecies differs from its relatives by dark legs, brighter orange color of bands and spots, wider forewing band, and larger and rounder inner forewing margin spot than in the nominate subspecies, but narrower discal band on the hindwing, especially beneath. A combination of the following DNA characters is diagnostic in the nuclear genome: hm2012473-RA.1:G201A, hm2012473-RA. 1:C210T, hm2011393-RA.1:T1506A, hm2011393-RA.1:A1725G, hm2015159-RA.5:C1024A and in COI barcode: T13T, G38G, A43A, T589C, T513T.</p><p>Barcode sequence of the holotype. Sample NVG-22117B06, GenBank PP254243, 658 base pairs: TACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAACATCTTTAAGACTTTTAATTCGAACTGAATTAGGAAACCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTTACAGCCCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTTCCATTAATATTAGGAGCTCCTGATATAGCTTTCCCTCGAA TAAATAATATAAGATTTTGATTACTACCTCCATCACTTATATTATTAATTTCTAGTAGTATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTACCCCCCACTTTCCTCCAATATTGC TCATAGCGGATCATCTGTTGATTTAGCAATTTTTTCTTTACATTTAGCAGGAATCTCTTCAATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGTATTAATAATATATCA TTTGATCAAATACCTTTATTTGTTTGAGCAGTAGGTATCACAGCTCTTTTATTATTATTATCATTACCAGTATTAGCAGGAGCTATTACCATACTTTTAACTGACCGAAATATTAATACAT CATTTTTTGACCCAGCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTT</p><p>Type material. Holotype: ♂ deposited in the collection of Museum für Naturkunde, Berlin, Germany [MFNB], illustrated in Fig. 5, bears four labels, 1 st handwritten, others printed: three white [13 | VII], [Bogota | Nolcken], [DNA sample ID: | NVG-22117B06 | c/o Nick V. Grishin], and one red [HOLOTYPE ♂ | Microtia elva | bogotana Grishin] . Paratype: 1♀ the same locality, collector, and repository as the holotype (NVG-22117B07, bears an additional erroneous handwritten label “ Brasilien ”) .</p><p>Type locality. Colombia: Bogota .</p><p>Etymology. The name refers to the type locality.</p><p>Distribution. Colombia.</p><p>Comments. The lack of separation of subspecies into clades in the genomic trees (e.g., M. elva horni vs. M. elva horni) does not mean that the subspecies are not valid, it only means that this phylogenetic method does not separate them. Such a situation can arise due to limited genetic differentiation and/or extensive gene flow. Population analysis is needed to define groups of populations that are best treated as subspecies if phylogenetic tree methods fail. Finally, further research and additional specimens are needed to investigate whether M. elva bogotana ssp. n. might be a species-level taxon.</p></div>	https://treatment.plazi.org/id/C45B002EFFE9FF85E1A2AB41741B3660	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFE6FF87E1A6A9C874E735CC.text	C45B002EFFE6FF87E1A6A9C874E735CC.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Boloria astarte subsp. alaskia Zhang & Cong & Shen & Song & Grishin 2024	<div><p>Boloria astarte alaskia Grishin, new subspecies</p><p>http://zoobank.org/ 2B44E674-0784-4977-ADE5-A8AD69E30582 (Figs. 6 part, 7a)</p><p>Definition and diagnosis. Genomic analysis that includes the holotype of Boloria astarte tschukotkensis (Wyatt, 1961) (type locality in Russia: Chukotka Mts., sequenced as NVG-20095A04) reveals that Boloria astarte (E. Doubleday, [1847]) (type locality in Canada: Alberta) partitions into four, not three, distinct clades. Three clades correspond to subspecies of B. astarte: the nominate (Fig 6 green), Boloria astarte distincta (A. Gibson, 1920) (type locality in Canada: Yukon, Harrington Creek) (Fig 6 blue), and B. astarte tschukotkensis (Fig 6 purple). The fourth clade (Fig 6 red) comprises populations from Alaska, USA, that are currently called B. astarte tschukotkensis but, as our analysis shows, are genetically distinct from it. While forming a prominent clade in the nuclear genome tree (Fig. 6a), these populations from Alaska exhibit only 0.3% (2 bp) difference in the COI barcode from the nominate B. astarte . Therefore, this Alaskan clade represents a new subspecies. This new subspecies differs from others by its generally smaller size, less extensive white overscaling beneath, e.g., near the outer margin of the ventral hindwing, the submarginal row of spots is not covered with white, and white scaling is mostly restricted to the belt between the marginal and submarginal row of spots. The submarginal spots are rounder on the ventral side, not triangular as in B. astarte distincta (Fig. 6a vs. b). A notable difference is that the submarginal spots on the ventral forewing point outside (towards the margin) with their sharper ends in the new subspecies but inside (towards the wing base) in B. astarte distincta . The new subspecies differs from B. astarte tschukotkensis by better defined submarginal spots and weaker expressed and narrower dark framing in the discal area of ventral hindwing. A combination of the following DNA characters in the nuclear genome is diagnostic: hm2009446-RA.6:T96A, hm2010326-RA.1:G46A, hm2002793-RA.5:C72T, hm2010724-RA.2:T198A, hm2010724-RA.2:C255A but COI barcodes do not identify it consistently.</p><p>Barcode sequence of the holotype. Sample NVG-21068B11, GenBank PP254244, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACATCTCTTAGTTTACTAATTCGAACTGAATTAGGTAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGTAATTGATTAGTACCTTTAATATTAGGAGCCCCAGATATAGCATTTCCCCGTA TAAATAATATAAGATTTTGACTTTTACCCCCATCTTTAATTTTACTTATTTCAAGTAGAATTGTCGAAAATGGAGCAGGAACAGGATGAACAGTGTACCCCCCACTTTCATCTAATATTGC TCATAGAGGAGCTTCAGTAGACCTAGCAATTTTTTCTCTACATTTAGCTGGTATTTCCTCCATCCTAGGAGCTATTAATTTTATTACCACAATTATTAATATACGGATTAATAATATATCT TTTGATCAAATACCATTATTTGTATGAGCTGTAGGTATTACAGCTTTATTACTTTTATTATCTTTACCAGTTTTAGCAGGAGCTATTACAATACTTTTAACTGATCGTAATTTAAATACTT CATTTTTTGATCCTGCAGGAGGAGGAGATCCCATTTTATATCAACATTTATTT</p><p>Type material. Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity, Florida Museum of Natural History, Gainesville, FL, USA [MGCL], illustrated in Fig. 7, bears four labels, 1 st handwritten, others printed: three white [Omilak, Darby Mtns | Alaska | June 24, 1986 | Collectors | J + L Troubridge], [J. &amp; F. Preston Coll. | Allyn Museum | Acc. 1989-21], [DNA sample ID: | NVG-21068B11 | c/o Nick V. Grishin], and one red [HOLOTYPE ♂ | Boloria astarte | alaskia Grishin]. Paratypes: 2♂♂ and 2♀♀: from USA: Alaska: 1♂ Seward Peninsula, Kougarok Road, mile 48, Big Creek, elevation 1100 ft, 16-Jul-1979, Joseph D. Zeligs leg. (NVG-22039A05, fig. James Scott book, from James A. Scott collection); 1♀ Brooks Range, Chandalar Shelf Ridge, W of Dalton Hwy mile 237.5, 24-25-Jun-1999, Malcolm G. Douglas leg. (NVG-21068C01) [MGCL]; North Slope Borough, Dalton Highway, W. R. Dempwolf leg.: 1♂ N of Atigun Pass, elevation 2784', GPS 68.1558, −149.4361, 12-Jul- 2021 (NVG-22059C05, WRD 20230) and 1♀ near Atigun Pass, elevation 3700', GPS 68.1397, −149.4439, 11-Jul-2021 (NVG-22059C06, WRD 20229).</p><p>Etymology. The name refers to the state of the type locality.</p><p>Distribution. From the Seward Peninsula to the Brooks Range in Alaska, USA.</p></div>	https://treatment.plazi.org/id/C45B002EFFE6FF87E1A6A9C874E735CC	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFE4FF87E0C0AB3C71BA3783.text	C45B002EFFE4FF87E0C0AB3C71BA3783.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Euselasia fayneli Gallard 2006	<div><p>Euselasia fayneli Gallard, 2006 belongs to the genus Erythia Hübner, [1819]</p><p>Genomic analysis of the holotype of Euselasia fayneli Gallard, 2006 (type locality in French Guiana, sequenced as NVG-23024F11) (Fig. 8 magenta) and representative Euselasiini Kirby, 1871 (1867) including type species of all available genus-group names (Fig. 8) reveals that it does not belong to Euselasia Hübner, [1819] (type species Euselasia gelaena Hübner, 1819, which is a junior subjective synonym of Papilio gelon Stoll, 1787), but instead originates within the genus Erythia Hübner, 1819 (type species Papilio labdacus Stoll, 1780). Therefore, we place it in this genus as Erythia fayneli Gallard, 2006, comb. nov.</p></div>	https://treatment.plazi.org/id/C45B002EFFE4FF87E0C0AB3C71BA3783	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFE4FF86E1B1AE82713E3473.text	C45B002EFFE4FF86E1B1AE82713E3473.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Ithomiola tessera (J. Hall 2005) J. Hall 2005	<div><p>Ithomiola tessera J. Hall, 2005 is a species distinct from Ithomiola theages (Godman &amp; Salvin, 1878)</p><p>Originally described and currently treated as a subspecies of Ithomiola theages (Godman &amp; Salvin, 1878) (type locality in Costa Rica) (Fig. 9 purple), Ithomiola theages tessera J. Hall, 2005 (type locality in COI barcodes differ by 3.5% (23 bp). Moreover, the two taxa differ by the size and alignment of white discal spots on the forewing (Hall 2005). Therefore, we propose that Ithomiola tessera J. Hall, 2005, stat. nov. is a species distinct from Ithomiola theages (Godman &amp; Salvin, 1878) . Furthermore, inspection of genomic trees reveals three new species that differ from the previously described ones due to their genetic differentiation even as single specimens (Fig. 9, yellow highlight in 9a). These three new species are described below.</p></div>	https://treatment.plazi.org/id/C45B002EFFE4FF86E1B1AE82713E3473	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFE5FF86E190ABF27243339D.text	C45B002EFFE5FF86E190ABF27243339D.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Ithomiola (Ithomiola) tesseroides Zhang & Cong & Shen & Song & Grishin 2024	<div><p>Ithomiola (Ithomiola) tesseroides Grishin, new species</p><p>http://zoobank.org/ 3400B799-BD7D-4126-95CE-0CF0766956D6</p><p>(Figs. 9 part, 10a)</p><p>Definition and diagnosis. Genome-based phylogeny of Ithomiola (Ithomiola) C. Felder &amp; R. Felder, 1865 (type species Ithomiola floralis C. Felder &amp; R. Felder, 1865) reveals that specimens from Panama (Fig. 9 red) identified as Ithomiola tessera J. Hall, 2005, stat. nov. (type locality in Mexico: Veracruz) (Fig. 9 blue) due to their large and blotchy white discal spots on the forewing are genetically differentiated from it at the species level (Fig. 9), e.g., their COI barcodes differ by 3.0% (20 bp), and therefore represent a new species. This species differs from its relatives by large and aligned discal white macules on the forewing that touch each other, as in I. tessera, from which its females can be differentiated by typically larger discal macules on both wings (but usually smaller postdiscal spots) and hindwing discal macule stronger separated from costa by brown: small white spot in cell Sc+R 1 -Rs instead of a larger spot in typical I. tessera; and putative males (none sequenced) differ by more extensive blue scaling in the tornal area of dorsal hindwing. Because phenotypic variation of this species has not been explored and due to the absence of confirmed males, definitive identification is provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome: cne2399.14.5:A156G, cne6395.2.1:T631C, cne 1958.7.3:T204C, cne 1958.7.3:C477T, cne 1661.11.5:T813C and in COI barcode: A277C, C343T, T382A, T595C, T634C.</p><p>Barcode sequence of the holotype: Sample NVG-23013H06, GenBank PP254245, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGTACATCTTTAAGTTTATTAATTCGTATAGAATTAGGTATACCTGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGTTTTGGAAATTGACTTGTTCCTTTAATATTAGGAGCTCCAGATATAGCTTTTCCTCGTA TAAATAATATAAGATTTTGACTTCTTCCTCCTTCCTTATTTCTTCTTATTTCAAGAAGAATTGTTGAAAATGGTGCAGGTACTGGATGAACTGTTTACCCTCCTTTATCTTCTAACATTGC TCATGGAGGATCTTCTGTAGATTTAGCAATTTTCTCATTACATTTAGCAGGTATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACTATTATTAATATACGTATTAATAATTTATCA TTTGATCAAATACCTTTATTTGTATGATCTGTAGGAATTACAGCATTATTATTACTTTTATCTTTACCTGTATTAGCAGGTGCAATTACTATATTATTAACAGACCGAAACTTAAATACTT CATTTTTTGACCCTGCTGGAGGAGGTGACCCTATTCTTTATCAACATTTATTT</p><p>Type material. Holotype: ♀ deposited in the Zoologische Staatssammlung München, Germany [ZSMC], illustrated in Fig. 10a, bears three printed labels: two white [Chiriqui], [DNA sample ID: | NVG-23013H06 | c/o Nick V. Grishin] and one red [HOLOTYPE ♀ | Ithomiola (Ithomiola) | tesseroides Grishin] . Paratype: 1♀ with two original labels [920], [Theages | Godm. &amp; Salv. | Amaz.], likely mislabeled from Panama and might also be from Chiriqui (NVG-23013H12, GenBank barcode PP254246) [ZSMC] .</p><p>Type locality. Panama: Chiriqui .</p><p>Etymology. Formed from the name of I. tessera, which is a more northern species with similarly large and squarish adjoining discal forewing spots. In Latin, tessera means a square piece of stone, and it was given to that species for the forewing spots. The name is an adjective.</p><p>Distribution. Panama (at least).</p></div>	https://treatment.plazi.org/id/C45B002EFFE5FF86E190ABF27243339D	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFE5FF80E18CACA172F937F1.text	C45B002EFFE5FF80E18CACA172F937F1.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Ithomiola (Ithomiola) coladoris Zhang & Cong & Shen & Song & Grishin 2024	<div><p>Ithomiola (Ithomiola) coladoris Grishin, new species</p><p>http://zoobank.org/ 6C7200DE-F7A0-4DC0-A72D-317ACE584322 (Figs. 9 part, 10b)</p><p>Definition and diagnosis. Genome-based phylogeny of Ithomiola (Ithomiola) C. Felder &amp; R. Felder, 1865 (type species Ithomiola floralis C. Felder &amp; R. Felder, 1865) reveals that a specimen from Panama (Fig. 9 magenta) identified as Ithomiola cribralis (Stichel, 1915) (type locality in Ecuador) (Fig. 9 green) due to phenotypic similarities, is genetically differentiated from it at the species level (Fig. 9), e.g., their COI barcodes differ by 2.3% (15 bp), and therefore represents a new species. This species is most similar to its closest relative, I. cribralis, and differs from it by larger forewing white spots in both sexes (compare within each sex), larger hindwing discal white patch, and blue scaling extending farther from the tornus along the hindwing outer margin. For additional illustrations, see Figs. 62A (holotype), 62B (paratype), and 146 (male genitalia of the holotype) in Hall (2005), who has not illustrated true I. cribralis showing this species instead. Because the phenotypic variation of this species has not been extensively explored, definitive identification is provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome: cne10210.1.1:A505C, cne10210.1.1:A507G, cne804.5.4:A99G, cne41. 6.2:T747C, cne41.6.2:A777G, cne9763.1.7:C72C (not T), cne5785.2.3:C93C (not T), cne191.3.2:T87T (not C), cne10809.1.1:T36T (not C), cne6006.2.2:T132T (not A) and in COI barcode: T40A, T184C, T376C, A403G, T500C, T653C.</p><p>AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACATCTTTAAGATTATTAATTCGTATAGAATTAGGTATACCTGGATCTTTAATTGGTGATGATCAAATTTATAACACT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGCTTTGGAAATTGACTTGTTCCTTTAATGTTAGGAGCTCCAGATATAGCTTTTCCTCGTA TAAATAACATAAGATTTTGACTTTTACCTCCTTCATTAATTCTGCTTATTTCAAGAAGAATTGTTGAAAATGGTGCAGGTACTGGATGAACTGTTTACCCCCCTTTATCTTCTAATATTGC ACATGGAGGATCCTCTGTTGACTTAGCAATTTTTTCATTGCATTTAGCAGGTATTTCATCTATTTTAGGAGCTATTAATTTTATTACAACTATTATTAATATACGTATTAATAATTTATCA TTTGATCAAATACCTCTATTTGTTTGATCTGTAGGAATTACAGCATTACTATTACTTTTATCTTTACCTGTATTAGCAGGTGCTATTACTATATTATTAACAGATCGAAATTTAAATACTT CATTTTTTGATCCTGCTGGAGGAGGTGATCCTATTCTTTATCAACATCTATTT</p><p>Type material. Holotype: ♂ deposited in the National Museum of Natural History, Washington, DC, USA [USNM], illustrated in Fig. 10b, bears five printed (text in italics handwritten) labels: four white [PANAMA: PANAMA | Cerro Jefe 900 m. | IV-22.19 77 | G. B. Small], [Genitalia Dissection | #1999 - 62 | Donald J. Harvey], [DNA sample ID: | NVG-18122D02 | c/o Nick V. Grishin], [USNMENT | {QR Code} | 01532041], and one red [HOLOTYPE ♂ | Ithomiola (Ithomiola) | coladoris Grishin] . Paratype: 1♀ the same data as the holotype, illustrated by Hall (2005) as Fig. 62B (not sequenced) .</p><p>Type locality. Panama: Panama, Cerro Jefe, elevation 900 m.</p><p>Etymology. In Latin, cribrum means sieve or strainer and is a possible root of the name cribralis, given by Stichel to the sister of the new species, likely for the pattern of small white spots resembling small holes of a sieve. The new species has bigger spots, more similar to holes in colander, or colador in Spanish, hence the name, which is an adjective.</p><p>Distribution. Known only from Panama.</p></div>	https://treatment.plazi.org/id/C45B002EFFE5FF80E18CACA172F937F1	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFE3FF83E196A943747235C4.text	C45B002EFFE3FF83E196A943747235C4.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Ithomiola (Ithomiola) perutanos Zhang & Cong & Shen & Song & Grishin 2024	<div><p>Ithomiola (Ithomiola) perutanos Grishin, new species</p><p>http://zoobank.org/ 69184170-F545-4A05-9FEC-6A440A3747B0 (Figs. 9 part, 10c)</p><p>Definition and diagnosis. Genome-based phylogeny of Ithomiola (Ithomiola) C. Felder &amp; R. Felder, 1865 (type species Ithomiola floralis C. Felder &amp; R. Felder, 1865) reveals that a specimen from Cuzco, Peru (Fig. 9 orange) identified as Ithomiola bajotanos J. Hall, 2005 (type locality in Ecuador: Tungurahua) (Fig. 9 green) due to phenotypic similarities is genetically differentiated from it at the species level (Fig. 9), e.g., its COI barcode differs by 2.1% (14 bp) from I. bajotanos paratype from Colombia, and therefore represents a new species. This species is most similar to its closest relative, I. bajotanos, in size and less developed blue spots in the basal area of the dorsal forewing, and differs from it by smaller white spots in the ventral hindwing discal area in cells Sc+R 1 -Rs and Rs-M 1. These spots are larger than in a typical Ithomiola tanos (Stichel, 1910) (type locality in Bolivia, holotype sequenced as NVG-18078C09). Furthermore, forewing spots are, on average, smaller, and darker brown areas basad of spots on the ventral side are longer. Because phenotypic variation of this species has not been explored, definitive identification is provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome: cne7381.3.1:A60G, cne5239.2.2:T39C, cne5239.2.2:A129C, cne10306.1.1:C858T, cne7597.1.2:T96C, cne3123.5.1:T249T (not C), cne8031.2.1:C384C (not A), cne8031.2.1:T390T (not A), cne224.6.2:T48T (not A), cne123.8.6:C521C (not T) and in COI barcode: A46T, T124C, T205C, T265C, A474G, T499C, 508G.</p><p>Barcode sequence of the holotype: Sample NVG-19038C05, GenBank PP254248, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAATCGGAACTTCTTTAAGTTTATTAATTCGAATAGAATTAGGTACTCCAGGATCTTTAATTGGTGATGATCAAATTTATAACACT ATCGTTACAGCTCATGCTTTTATTATAATTTTCTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGACTTGTTCCCTTAATATTAGGAGCTCCAGATATAGCTTTCCCTCGTA TAAATAATATAAGATTTTGACTCCTTCCCCCTTCATTATTTCTTCTTATTTCAAGAAGAATTGTTGAAAATGGAGCAGGTACTGGATGAACTGTATATCCTCCTTTATCTTCTAATATTGC CCATGGAGGATCTTCTGTTGATTTAGCAATTTTCTCTTTACATTTAGCAGGTATTTCATCAATTTTAGGAGCTATTAATTTTATTACTACTATTATTAATATACGTATTAGTAATTTATCA TTTGATCAAATACCCTTATTTGTGTGATCAGTTGGTATTACAGCATTATTATTACTTTTATCTCTTCCTGTATTAGCAGGAGCTATTACTATATTATTAACAGATCGAAATTTAAATACTT CATTTTTTGATCCTGCTGGAGGAGGAGATCCTATTCTTTATCAACACTTATTT</p><p>Type material. Holotype: ♂ currently deposited in the National Museum of Natural History, Washington, DC, USA [USNM], illustrated in Fig. 10c, bears four printed labels: three white [PERU: Cuzco 1194 m. | Quebrada Santa Isabel | Cosnipata Valley 4738 | 27-III-2016 Kinyon], [DNA sample ID: | NVG-19038C05 | c/o Nick V. Grishin], [USNMENT | {QR Code} | 01544965], and one red [HOLOTYPE ♂ | Ithomiola (Ithomiola) | perutanos Grishin].</p><p>Type locality. Peru: Cuzco, Cosñipata Valley, <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=-71.5&amp;materialsCitation.latitude=-13.017" title="Search Plazi for locations around (long -71.5/lat -13.017)">Quebrada Santa Isabel</a>, elevation 1194 m, approximate GPS −13.017, −71.500 .</p><p>name), perutanos means tanos from Peru. The name is a noun in apposition.</p><p>Distribution. Known only from the holotype collected in Cuzco, Peru.</p></div>	https://treatment.plazi.org/id/C45B002EFFE3FF83E196A943747235C4	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFE0FF83E1AAAB6E75B13754.text	C45B002EFFE0FF83E1AAAB6E75B13754.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Lasaia callaina (Clench 1972) Clench 1972	<div><p>Lasaia callaina Clench, 1972 is a species distinct from Lasaia agesilas (Latreille, [1809])</p><p>Genomic analysis of Lasaia agesilas callaina Clench, 1972 (type locality in Mexico: San Luis Potosí) including its holotype (NVG-15099E07) reveals that it is genetically differentiated from the nominate Lasaia agesilas (Latreille, [1809]) (type locality in Peru) at the species level (Fig. 11) with Fst / Gmin of 0.27/0.008, although their COI barcodes differ only by 0.3% (2 bp). Moreover, it is sister to the clade of both L. agesilas agesilas and Lasaia aerugo Clench, 1972 (type locality in Peru). Therefore, we propose that Lasaia callaina Clench, 1972, stat. nov. is a species distinct from Lasaia agesilas (Latreille, [1809]) .</p></div>	https://treatment.plazi.org/id/C45B002EFFE0FF83E1AAAB6E75B13754	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFE0FF9DE205AE8973B136CF.text	C45B002EFFE0FF9DE205AE8973B136CF.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Lasaia pallida Zhang & Cong & Shen & Song & Grishin 2024	<div><p>Lasaia pallida Grishin, new species</p><p>http://zoobank.org/ 846287C6-261D-4A8E-AF3D-2AC49CA0895C</p><p>(Figs. 11 part, 12)</p><p>Definition and diagnosis. Genomic analysis of Lasaia H. Bates, 1868 (type species Papilio meris Stoll, 1781) reveals a clade of three specimens from Colombia and Venezuela (Fig. 11 red) sister to both L. peninsularis Clench, 1972 (type locality in Mexico: Yucatan) and L. sula Staudinger, 1888 (type locality in Honduras) in the nuclear genome tree (Fig. 11 cyan and purple). This clade consists of paler in appearance specimens not associated with any available name. In the COI barcodes, specimens from this clade differ by 4.7% (31 bp) from L. pseudomeris Clench, 1972 (type locality in Bolivia) and by 5.6% (37 bp) from L. sula . Therefore, this clade represents a new species. This new species differs from its relatives by a combination of the following characters: generally paler and greener, with less developed black spotting above mostly constrained to the forewing apex and anterior portion, paler areas towards costa on the dorsal side of both wings, two prominent subapical pale spots, hindwing with brown spots weakly developed, restricted to the area near the costa and in some specimens the base; ventrally darker than many other species, hindwing with paler basal third, most prominent nearly white area anterior of discal cell, but towards the outer margin it is only somewhat paler than the discal area, without contrasting pale patches in the submarginal area. The entire type series is illustrated (Fig. 12) because the three specimens differ in their appearance, giving a range of phenotypic variation in this species. Definitive identification is provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome:</p><p>and in COI barcode: T103C, A295T, T478C, T586G, A643G.</p><p>Barcode sequence of the holotype. Sample NVG-23014A03, GenBank PP254249, 658 base pairs:</p><p>AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGTACATCTTTAAGTTTATTAATTCGTATAGAATTAGGTATGCCAGGATCATTAATTGGTGACGATCAAATTTATAATACT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTCATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTACCTTTAATATTAGGAGCTCCTGATATAGCATTTCCACGAA TAAATAATATAAGATTTTGACTTTTACCTCCATCTTTATTTCTACTAATTTCTAGAAGTATTGTAGAAAACGGAGCAGGAACTGGATGAACAGTTTACCCCCCACTGTCTTCTAATATTGC TCATGGAGGATCTTCTGTAGATTTAGCTATTTTTTCTCTTCATTTAGCTGGAATTTCTTCAATTTTAGGAGCTATTAATTTTATTACAACTATTATTAATATACGAATTAATAACTTATCC TTTGATCAAATACCACTTTTTGTCTGATCAGTTGGTATTACTGCTTTATTATTATTATTATCATTACCTGTTTTAGCAGGAGCTATTACTATATTATTAACGGATCGTAATTTAAATACAT CTTTTTTTGATCCTGCAGGAGGAGGTGATCCAATTCTGTATCAACATTTATTC</p><p>Type material. Holotype: ♂ deposited in the Zoologische Staatssammlung München, Germany [ZSMC], illustrated in Fig. 12a, bears four labels, 2 nd handwritten, others printed: three white [Venezuela | Maracay | ges.P.Vogl], [ Lasaia | meris | Stoll], [DNA sample ID: | NVG-23014A03 | c/o Nick V. Grishin], and one red [HOLOTYPE ♂ | Lasaia pallida | Grishin]. Paratypes: 2♂♂: the same data as the holotype, 1936 (NVG-23014A04) and Colombia, Karsten leg. (NVG-22112G05) [MFNB].</p><p>Type locality. Venezuela: Maracay .</p><p>Etymology. In Latin, pallidus means pale or pallid. The name refers to the paler appearance of this species, particularly towards the costa on both wings above and the basal third of the hindwing beneath, and is a feminine adjective.</p><p>Distribution. Colombia and Venezuela.</p><p>Comments. Although we have not yet sequenced Lasaia meris (Stoll, 1781) (type locality in Suriname) and Lasaia maritima J. Hall &amp; Lamas, 2001 (type locality in Peru: Piura), Lasaia pallida sp. n. is a species distinct from them. From the original illustration, L. meris is a strongly patterned species with well-developed pale submarginal areas on the hindwing (Stoll 1780 –1782), and thus differs from leastpatterned Lasaia pallida sp. n. Querying BOLD database (Ratnasingham and Hebert 2007) with COI barcodes of our sequenced specimens reveals that L. maritima is a species closely related to Lasaia agesilas (Latreille, [1809]) (type locality in Peru), similarly to Lasaia aerugo Clench, 1972 (type locality in Peru: Cajamarca), and thus different from Lasaia pallida sp. n.</p></div>	https://treatment.plazi.org/id/C45B002EFFE0FF9DE205AE8973B136CF	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFFEFF9CE1BEAE7E729E309F.text	C45B002EFFFEFF9CE1BEAE7E729E309F.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Lasaia sessilis subsp. oaxacensis Zhang & Cong & Shen & Song & Grishin 2024	<div><p>Lasaia sessilis oaxacensis Grishin, new subspecies</p><p>http://zoobank.org/ B74DED29-8359-4AF6-AB20-E564AC968987</p><p>(Figs. 13 part, 14)</p><p>Definition and diagnosis. Genomic analysis of Lasaia H. Bates, 1868 (type species Papilio meris Stoll, 1781) reveals that a specimen from Oaxaca, Mexico (Fig. 13 magenta, 14) is genetically differentiated from Lasaia sessilis Schaus, 1890 (type locality in Mexico: Veracruz, Coatepec, syntype sequenced as NVG-18048A05) (Fig. 13 blue), but not very prominently, e.g., their COI barcodes differ by 1.4% (9 bp). Therefore, this specimen represents a new taxon that we regard as a subspecies. This new subspecies is most similar to L. sessilis but differs from it by forewing dark dashes that are narrower, more connected with each other (rather than forming separate spots), and weaker developed than in L. sessilis, but hindwing dashes are better expressed on the dorsal side, especially towards the inner margin where they typically fade in L. sessilis, and costal area of dorsal hindwing paler than in a typical L. sessilis . Due to unexplored phenotypic variation, definitive identification is provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome: cne3288.5.1:C402G, cne205.20.3:T84C, cne640. 6.18:A55G, cne640.6.18:T75C, cne7.2.1:T15A, cne7425.7.4:A24A (not G), cne 1806.4.1:T119T (not C), cne790.10.6: C57C (not G), cne10214.8.11:G63G (not A), cne49345.1.3:T60T (not C) and in COI barcode: T49A, A241A, A295A, T403C, T616C.</p><p>Barcode sequence of the holotype. Sample NVG-19069B11, GenBank PP254250, 658 base pairs: AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGTACATCATTAAGTTTATTAATTCGTATAGAATTAGGTATACCAGGATCATTAATTGGTGATGATCAAATTTATAATACT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATCATAATTGGAGGTTTTGGAAATTGATTAGTACCATTAATATTAGGAGCACCTGATATAGCATTTCCACGAA TAAATAATATAAGATTCTGACTTCTTCCCCCATCTTTATTTCTTTTAATTTCAAGAAGTATTGTAGAAAATGGAGCAGGAACTGGATGAACAGTTTACCCCCCACTGTCTTCTAATATTGC TCATAGAGGATCCTCAGTAGATTTAGCTATTTTTTCTCTCCATTTAGCTGGAATTTCATCTATTTTAGGAGCTATTAATTTTATTACAACTATTATTAATATACGTATTAATAATTTATCT TTTGATCAAATACCATTATTTATCTGATCAGTTGGTATTACTGCTTTATTATTATTATTATCTTTACCAGTTTTAGCAGGAGCTATTACAATATTATTAACAGACCGTAATTTAAATACAT CTTTTTTTGACCCAGCAGGAGGTGGAGATCCAATTTTATATCAACATTTATTT</p><p>Type material. Holotype: ♂ deposited in the University of Texas Biodiversity Center insect collection, Austin, TX, USA [TMMC], illustrated in Fig. 14, bears five labels: 3 rd handwritten, others printed; 2 nd and 5 th red, others white: [Mexico: Oaxaca, | La Soledad – Buena Vista | ~5000' 5-6.v.1990 | J. Kemner leg. #200], [Texas Memorial | Museum –UTexas | JKemner Spec. | 1197], [200], [DNA sample ID: | NVG-19069B11 | c/o Nick V. Grishin], and [HOLOTYPE ♂ | Lasaia sessilis | oaxacensis Grishin]. The numbers 1197 and 200 refer to the specimen and the locality, respectively, in the Kemner files in TMMC collection. The first label was made for the holotype using data in these files and added to the specimen together with the last (holotype) label. Only the 2 nd and 3 rd labels were original labels on this specimen.</p><p>Type locality. Mexico: Oaxaca, Sierra Madre del Sur, La Soledad – Buena Vista, elevation ca. 5000 ’.</p><p>Etymology. The name refers to the type locality and is a feminine adjective.</p><p>Distribution. Currently known only from the holotype collected in Oaxaca, Mexico.</p><p>Comment. Further research and additional specimens are needed to investigate whether L. sessilis oaxacensis ssp. n. could be a species-level taxon.</p></div>	https://treatment.plazi.org/id/C45B002EFFFEFF9CE1BEAE7E729E309F	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFFFFF9FE1BAAFAF756C3046.text	C45B002EFFFFFF9FE1BAAFAF756C3046.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Synargis attilius (Stichel 1925) Zhang & Cong & Shen & Song & Grishin 2024	<div><p>Synargis attilius (Stichel, 1925) is a species distinct from Synargis regulus (Fabricius, 1793)</p><p>Genomic analysis of two syntypes of Nymula regulus attilius Stichel, 1925 (type locality in Brazil: Rio de Janeiro; sequenced as NVG-21119F06 and NVG-21119F07) reveals that, together with other specimens from Southeast and South Brazil (Fig. 15 blue), they are sister to and genetically differentiated from Synargis regulus (Fabricius, 1793) (Fig. 15 olive) at the species level, e.g., their COI barcodes differ by 6.7% (44 bp). Therefore, we propose that Synargis attilius (Stichel, 1925) stat. nov. is a species distinct from Synargis regulus (Fabricius, 1793) .</p><p>Zimsen (1964) did not specify repositories of S. regulus syntypes, which were from the Drury collection. We are not aware of their whereabouts and are researching this question. Presently, short of a neotype designation if no syntypes can be located, our identification of this species is based on the Jones’ illustration (Oxford University Museum of Natural History 2021), which shows a comparatively large female with broad pale-yellow markings and a ventral hindwing brown border without a pair of yellow marginal spots inside it. According to our analysis, only one species of the S. regulus complex lacks these yellow spots. It is a Southeast Brazilian species, where it may be sympatric with S. attilius .</p><p>We identify the “ holotype ” of an infrasubspecific name Nymula regulus regulus forma ingens Stichel, 1925 (from Brazil: Espirito Santo, sequenced as NVG-21119F08) referring to a “giant form” of the species (Stichel 1925) as S. regulus, in agreement with Stichel. However, not all S. regulus specimens are that large, and NVG-21119F08 is smaller than an average S. attilius . Besides the absence of yellow marginal spots inside the brown ventral hindwing marginal area, males of S. regulus can be distinguished from S. attilius by a more concave outer edge and more convex inner edge of the postbasal yellow band near the inner margin of the dorsal hindwing (i.e., more crescent-shaped postbasal dorsal hindwing band). In addition to S. regulus and S. attilius being distinct species, the genomic analysis revealed five more species in the S. regulus complex (Fig. 15). All five are new and they are described below.</p></div>	https://treatment.plazi.org/id/C45B002EFFFFFF9FE1BAAFAF756C3046	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFFCFF9EE216AFF274ED3375.text	C45B002EFFFCFF9EE216AFF274ED3375.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Synargis regina Zhang & Cong & Shen & Song & Grishin 2024	<div><p>Synargis regina Grishin, new species</p><p>http://zoobank.org/ 0AD77735-F840-4304-BD2A-5562AC4181AC (Figs. 15 part, 16a)</p><p>Definition and diagnosis. A sole specimen from the S. regulus group that we sequenced from Chanchamayo, Peru (Fig. 15 magenta) is genetically differentiated from its sister clade composed of specimens from Brazil: Pará (which belong to another new species described below) (Fig. 15 green) at the species level: e.g., their COI barcodes differ by 2.3% (15 bp). Therefore, this female with a unique phenotype (Fig. 16a) represents a new species. This new species differs from its relatives by extensive and broad yellow areas on wings (even broader than in S. regulus), including broader submarginal macules on the forewing that are nearly touching each other, narrower broad bands, smaller marginal yellow spots on ventral side near each wing’s tornus (absent in S. regulus) and lacking yellow marginal spot in cell M 3 - CuA 1 (absent in S. regulus but present in species with broad yellow bands). Due to unexplored phenotypic variation, definitive identification is provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome: cne30383.1.1:C324T, cne30383.1.1:A327C, cne2564.25.13:G51A,</p><p>cne3039.2.4:C36T, cne3039.2.4:A141T, cne 2462.3.2:C153C (not T), cne8137.3.1:G420G (not T), cne5683.4.1: T929 T (not A), cne17882.2.1:A79A (not G), cne 1029.3.3:C114C (not T) and in COI barcode: T85 C, G337G, T400 C, A562G, A619C.</p><p>Barcode sequence of the holotype. Sample NVG-22117D06, GenBank PP254251, 658 base pairs: AACTTTATATTTTATTTTTGGAATCTGAGCAGGTATAATAGGAACATCTCTTAGTTTATTAATTCGAATAGAATTAGGAATTCCCGGTTCTTTAATTGGAAATGATCAAATTTATAATACT ATTGTTACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCATTAATATTAGGAGCTCCAGATATAGCTTTCCCTCGTA TAAATAATATAAGATTTTGATTATTACCCCCATCTTTATTTTTATTAATTTCTAGAAGAATTATTGAAAATGGAGCAGGAACTGGATGAACTGTGTACCCCCCACTTTCATCTAATATTGC TCATAGAGGAGCTTCTGTTGATTTAGCTATTTTTTCCCTTCATTTAGCTGGAATTTCATCAATTTTAGGTGCAATTAATTTTATTACAACTATTATTAATATACGTATTAATAATTTATCA TTTGATCAAATACCTTTATTTATTTGATCTGTAGGAATTACTGCTCTTCTTCTTTTATTATCTTTACCTGTTTTAGCGGGAGCTATTACTATACTACTTACAGATCGAAATTTAAATACAT CTTTTTTTGATCCCGCAGGAGGTGGAGATCCAATTTTATATCAACATTTATTT</p><p>Type material. Holotype: ♀ currently deposited in the collection of Museum für Naturkunde, Berlin, Germany [MFNB], illustrated in Fig. 16a, bears five labels: 2 nd handwritten and others printed; 1 st green, 5 th red, and others white [Chanchamayo | G.Tessmann], [spec. | (cf. zonata) | ♀ | 583] (the number is rotated 90° counterclockwise relative to the rest of the text and written along the right side of the label), [ex coll. | H. STICHEL], [DNA sample ID: | NVG-22117D06 | c/o Nick V. Grishin], and [HOLOTYPE ♀ | Synargis | regina Grishin].</p><p>Type locality. Peru: Chanchamayo .</p><p>Etymology. In Latin, regulus means little king or prince. It is a diminutive form of rex, which means king. In Latin, regina means queen, and this name is given to this brightest species of the group. The name is a noun in apposition.</p><p>Distribution. Currently known only from the holotype collected in central Peru.</p></div>	https://treatment.plazi.org/id/C45B002EFFFCFF9EE216AFF274ED3375	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFFDFF99E1E5ACC572EF3114.text	C45B002EFFFDFF99E1E5ACC572EF3114.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Synargis reginella Zhang & Cong & Shen & Song & Grishin 2024	<div><p>Synargis reginella Grishin, new species</p><p>http://zoobank.org/ 8F95EA60-6CD3-4B47-93CA-78E8E3A130B0 (Figs. 15 part, 16b)</p><p>Definition and diagnosis. Several specimens from the S. regulus group collected in Brazil: Pará (Fig. 15 green) are genetically distinct from all others at the species level, e.g., COI barcode difference from their sister S. regina sp. n. (Fig. 15 magenta) is 2.3% (15 bp). Therefore, they represent a new species. This new species differs from its relatives by broader yellow bands and submarginal yellow macules, which are ventral side (including a comparatively large yellow spot in cell M3-CuA1) fully penetrating the brown border and connected with the postdiscal yellow area, and dorsally brown abdomen in males. Due to unexplored phenotypic variation, definitive identification is provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome: cne294.1.1:G44T, cne294.1.1:C59G, cne 2806.2.1: T90C, cne935.2.3:G351A, cne935.2.3:C354T and in COI barcode: A94G, C235T, T283C, T454C, T646C. Barcode sequence of the holotype. Sample NVG-22117E03, GenBank PP254252, 658 base pairs: AACTTTATATTTTATTTTTGGAATCTGAGCAGGTATAATAGGAACATCTCTTAGTTTATTAATTCGAATAGAATTAGGAATTCCTGGTTCTTTGATTGGAAATGATCAAATTTATAATACT ATTGTTACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAATTCCATTAATATTAGGAGCTCCAGATATAGCTTTTCCTCGTA TAAATAATATAAGATTTTGATTATTACCTCCATCTTTATTCTTATTAATTTCTAGAAGAATTATTGAAAATGGAGCAGGAACTGGATGAACTGTATATCCCCCACTTTCATCTAATATTGC TCATGGAGGAGCTTCTGTTGATTTAGCTATTTTTTCTCTTCATTTAGCTGGAATTTCATCAATTTTAGGTGCAATTAATTTTATTACAACCATTATTAATATACGTATTAATAATTTATCA TTTGATCAAATACCTTTATTTATTTGATCTGTAGGAATTACTGCTCTTCTTCTTTTATTATCTTTACCTATTTTAGCAGGAGCTATTACTATACTACTTACAGATCGAAATTTAAATACAT CTTTTTTTGACCCCGCAGGAGGTGGAGATCCAATTTTATACCAACATTTATTT</p><p>Type material. Holotype: ♀ currently deposited in the collection of Museum für Naturkunde, Berlin, Germany [MFNB], illustrated in Fig. 16b, bears four printed labels: three white [Itait. | Mich.], [ex coll. | H. STICHEL], [DNA sample ID: | NVG-22117E03 | c/o Nick V. Grishin], and one red [HOLOTYPE ♀ | Synargis | reginella Grishin]. According to the 1 st label, the holotype was collected in Itaituba (Pará, Brazil) by Michael, probably in 1890. This year is on a similarly styled label of the topotypical paratype. A female is chosen as the holotype for best comparison with female primary types of S. regina sp. n. and Jones’ drawing S. regulus . Paratypes: 2♂♂ and 2♀♀ from Brazil, Pará [MFNB]: 1♂ the same data as the holotype, 1890 (NVG-22117D07) and from Santarem: 1♂ (NVG-22117E01, Stichel collection number 1620), 1♀ (NVG-22117E02, Stichel No 2088), and 1♀ (NVG-22117E04, Stichel No 315).</p><p>Type locality. Brazil: Pará, Itaituba .</p><p>Etymology. In Latin, regulus means little king or prince. It is a diminutive form of rex, which means king. In Latin, reginella is a diminutive of regina, which means queen, and the name is given to this species that resembles regina but is not that bright. The name is a noun in apposition.</p><p>Distribution. Lower Amazonian region.</p></div>	https://treatment.plazi.org/id/C45B002EFFFDFF99E1E5ACC572EF3114	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFFAFF9BE1E9AE2272DC3499.text	C45B002EFFFAFF9BE1E9AE2272DC3499.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Synargis flavicauda Zhang & Cong & Shen & Song & Grishin 2024	<div><p>Synargis flavicauda Grishin, new species</p><p>http://zoobank.org/ BA27EC2B-4A69-4C68-8273-F82B8FCE2E74 (Figs. 15 part, 17a)</p><p>Definition and diagnosis. Genomic analysis of the S. regulus group reveals a clade that, being distinct from all other species, itself consists of three species-level undescribed taxa (Fig. 15 red, purple, and orange). The first species (Fig. 15 red) with specimens sequenced from Peru differs in COI barcode from each of the other two species by 2.6% (17 bp). This new species is differentiated from its relatives by narrower than in several others yellow bands and submarginal macules, strongly developed marginal yellow spots inside brown border on the ventral side of wings, including the spot in cell M 3 -CuA 1; this spot is connected or nearly connected with the subapical elongated macule. Many males have a dorsally yellow caudal half of the abdomen (yellow ventrally as in other species). Due to unexplored phenotypic variation, definitive identification is provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome: cne664.10.2:C508A, cne664.10.2:C519 T , cne 2800.7.1:C655G, cne 2800.7.1:C660A, cne9234.1.8: T88 C and in COI barcode: T103 C, C340 T, T407 C, A451C, T578 C.</p><p>Barcode sequence of the holotype. Sample NVG-22117E05, GenBank PP254253, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGTATAGTAGGAACATCTCTTAGTTTACTAATTCGAATAGAATTAGGAACTCCTGGATCTTTAATTGGAGACGATCAAATTTATAATACT ATTGTTACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAACTGATTAGTTCCATTAATATTAGGAGCTCCTGATATAGCTTTCCCCCGTA TAAATAATATAAGATTTTGATTATTACCTCCTTCTTTATTTTTATTAATCTCCAGAAGAATTGTTGAAAATGGAGCAGGAACTGGATGAACAGTATATCCCCCACTTTCATCTAATATTGC TCATAGAGGAACTTCTGTTGATTTAGCTATTTTTTCTCTTCATCTAGCTGGAATTTCATCAATCTTAGGTGCAATTAATTTTATTACCACTATTATTAATATACGTATTAATAATTTATCA TTTGATCAAATACCTTTATTTGTTTGATCAGTAGGAATTACTGCTCTTCTTCTTTTATTATCATTACCTGTTTTAGCGGGAGCTATTACTATACTACTTACTGATCGAAATTTAAACACAT CTTTTTTTGATCCTGCAGGAGGTGGAGATCCAATTTTATATCAACATTTATTT</p><p>Type material. Holotype: ♂ currently deposited in the collection of Museum für Naturkunde, Berlin, Germany [MFNB], illustrated in Fig. 17a, bears four labels: 2 nd handwritten and others printed; 1 st green, 4 th red, and others white [Mt. Alegre, Rio | Pachitea O. Peru | G.Tessmann], [regulus F. | f. sylvarum Bat.], [DNA sample ID: | NVG-22117E05 | c/o Nick V. Grishin], and [HOLOTYPE ♂ | Synargis |</p><p>22117D04 and NVG-22117E06) and 1♂ from Peru: Chanchamayo, G. Tessmann leg. (NVG-22117D05) .</p><p>Type locality. Peru: Rio Pachitea, Monte Alegre. This is also the type locality of Pseudophaloe tessmanni Hering, 1925 ( Erebidae: Arctiinae) and Hylesia natex Draudt, 1929 ( Saturniidae).</p><p>Etymology. In Latin, flavus means yellow or golden, and cauda means tail. The compound word flavicauda refers to the yellow distal half of the abdomen dorsal side in males of this species. This coloration may also be present in other species of the group but is typically less pronounced. The name is an adjective.</p><p>Distribution. Central and East-central Peru.</p></div>	https://treatment.plazi.org/id/C45B002EFFFAFF9BE1E9AE2272DC3499	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFF8FF9AE1FBABAB7490309B.text	C45B002EFFF8FF9AE1FBABAB7490309B.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Synargis tenebritorna Zhang & Cong & Shen & Song & Grishin 2024	<div><p>Synargis tenebritorna Grishin, new species</p><p>http://zoobank.org/ A7E8E1AF-38EC-4843-8120-1F42E07E6601 (Figs. 15 part, 17b)</p><p>Definition and diagnosis. Genomic analysis of the S. regulus group reveals a clade that, being distinct from all other species, itself consists of three species-level undescribed taxa (Fig. 15 red, purple, and orange). The second species (Fig. 15 purple) with specimens sequenced from Brazil: Bahia and with incomplete or missing data (likely from Southeast Brazil) differs in COI barcode by 2.6% (17 bp) from S. flavicauda sp. n. and by 2.0% (13 bp) from the new species described next. This new species is differentiated from its relatives by narrower than in nearly all other species yellow bands and submarginal macules, discal bands not much wider than submarginal bands and macules, weaker developed (but present) marginal yellow spots inside brown border on the ventral side of wings, including a small spot in the cell M 3 -CuA 1 that does not reach subapical elongated macule, more strongly defined than in other species dark brown area by tornus on the ventral hindwing, mostly dorsally brown abdomen, and larger size, similar to that of many specimens of S. regulus . Due to unexplored phenotypic variation, definitive identification is provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome: cne4191.9.4:T63C, cne 1381.2.3:C702T, cne3677.1.5:C150T, cne3677.1.5:C151T, cne1498. 4.1:C82A and in COI barcode: G200A, T367C, A451C, T526A, T542C.</p><p>Barcode sequence of the holotype. Sample NVG-22117C08, GenBank PP254254, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGTATAATAGGAACATCTCTTAGTTTATTAATTCGAATAGAATTAGGAACTCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTTACAGCTCATGCATTTATTATAATTTTTTTTATAATTATACCTATTATAATTGGAGGATTTGGAAACTGATTAATTCCATTAATATTAGGAGCTCCAGATATAGCTTTCCCCCGTA TAAATAATATAAGATTTTGATTATTACCTCCTTCTTTATTTTTATTAATCTCCAGAAGAATTGTTGAAAATGGAGCAGGAACTGGATGAACAGTGTACCCCCCACTTTCATCTAATATTGC TCACAGAGGAACTTCTGTTGATTTAGCCATTTTTTCTCTTCATTTAGCTGGAATTTCATCAATCTTAGGTGCAATTAATTTTATTACCACTATTATTAATATACGTATTAATAATTTATCA TTTGATCAAATACCTTTATTTGTTTGATCTGTAGGAATTACAGCTCTTCTTCTTTTACTATCATTACCTGTTTTAGCAGGAGCTATTACTATATTACTTACTGATCGAAATTTAAATACAT CTTTTTTTGATCCTGCAGGAGGTGGAGATCCAATTTTATATCAACATTTATTT</p><p>Type material. Holotype: ♂ currently deposited in the collection of Museum für Naturkunde, Berlin, Germany [MFNB], illustrated in Fig. 17b, bears four printed (text in italics handwritten): three white [Bahia, Para | Sello | Sieber / Hist. Coll. | Nr. 3827] (text after / is on the other side of the label), [ex coll. | H. STICHEL], [DNA sample ID: | NVG-22117C08 | c/o Nick V. Grishin], and one red [HOLOTYPE ♂ | Synargis | tenebritorna Grishin]. The 1 st label of the holotype was added during the subsequent curation of historical collections by Andree Salk. Originally, the holotype was an unlabeled specimen in a series with the handwritten header label [Regulus | Fan God Don. | Baeotis Regulus | Wstw | Bah. Sello, Pará Sieb] on the specimen bearing a label with the number 3827 (a paratype of the species described next). Some specimens in this series are from Bahia, and others from Pará. The series consists of two species. The second species (described next) is Amazonian, and we deduce that it was collected in Pará by Friedrich Wilhelm Sieber (1775–1831). Therefore, we hypothesize that this species was collected in Bahia, Brazil, by Friedrich Sello[w] (1789–1831). Paratypes: 1♂ from Brazil, Maassen collection (NVG-21119F09) and 1♀ no data, Weymer collection (NVG-21119F10), both in MFNB.</p><p>Type locality. Brazil: Bahia .</p><p>Etymology. In Latin, tenebrosus means dark and describes something full of shadows or gloom, emphasizing the atmosphere of darkness. The name is a compound word of tenebrosus and tornus to indicate the dark ventral hindwing tornus. The name is an adjective.</p><p>Distribution. Brazil, specifically recorded from Bahia.</p><p>http://zoobank.org/ 986F2867-69C7-416F-8B88-FA3092BBFAC6 (Figs. 15 part, 17c, d)</p><p>Definition and diagnosis. Genomic analysis of the S. regulus group reveals a clade that, being distinct from all other species, itself consists of three species-level undescribed taxa (Fig. 15 red, purple, and orange). The first species (Fig. 15 orange) with specimens sequenced from French Guiana and Brazil: Pará differs in COI barcode by 2.0% (13 bp) from S. tenebritorna sp. n. from and by 2.6% (17 bp) from S. flavicauda sp. n. This new species is differentiated from its relatives by narrower than in some others yellow bands and submarginal macules, discal band at least twice the width of the submarginal band and macules (the hindwing discal band is even broader comparatively to the submarginal band in the paratype, Fig. 17d), weakly developed marginal yellow spots inside brown border on the ventral side of wings, and the spot in cell M 3 -CuA 1 that is either missing or vestigial at least on the forewing, darker tornal area on ventral hindwing is visible but weaker than in S. tenebritorna sp. n. Males could be with dorsally yellow caudal half of abdomen (yellow ventrally as in other species). Due to unexplored phenotypic variation, definitive identification is provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome: cne1775.24.4:C93A, cne5268.4.1:T390C, cne656.6.1:C168T, cne5798.2.3:T168C, cne 2799.9.1:A501G, cne8392.1.3:G87A, cne5383.1.4:A156G, cne5265.4.1:G5775A, cne11854.1.1:A493G, cne6377.3.2:T159T (not C) and in COI barcode: G87A, A409G, T487C, T526T, T542C.</p><p>Barcode sequence of the holotype. Sample NVG-22117C04, GenBank PP254255, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGTATAGTAGGAACATCTCTTAGTTTATTAATTCGAATAGAATTAGGAACTCCTGAATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTTACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAACTGATTAGTTCCATTAATATTAGGAGCTCCAGATATAGCTTTTCCCCGTA TAAATAATATAAGATTTTGATTATTACCTCCTTCTTTATTTTTATTAATCTCCAGAAGAATTGTTGAAAATGGAGCAGGAACTGGATGAACAGTGTACCCCCCACTTTCATCCAATATTGC TCATAGAGGAACTTCTGTTGATTTAGCCATTTTTTCTCTTCATTTGGCTGGAATTTCATCAATCTTAGGTGCAATTAATTTTATTACCACTATTATTAATATACGTATTAATAATTTATCA TTCGATCAAATACCTTTATTTATTTGATCAGTAGGAATTACTGCTCTTCTTCTTTTACTATCATTACCTGTTTTAGCTGGAGCTATTACTATATTACTTACTGATCGAAATTTAAATACAT CTTTTTTTGATCCTGCAGGAGGTGGAGATCCAATTTTATATCAACATTTATTT</p><p>Type material. Holotype: ♂ deposited in the collection of Museum für Naturkunde, Berlin, Germany [MFNB], illustrated in Fig. 17c, bears four labels, 2 nd handwritten on glassine paper likely cut out of the envelope that contained this specimen, others printed: three white [French Guyana | Roura, Galion | 28.04.1991 | leg. C. Brévignon], [28.IV.1991 | Galion] (has other marks), [DNA sample ID: | NVG-22117C04 | c/o Nick V. Grishin], and one red [HOLOTYPE ♂ | Synargis | latidifa Grishin] . Paratype: 1♂ from Brazil: Pará, F. Sieber leg. (NVG-22117C06, GenBank barcode PP254256; the header specimen with the historical collection number label 3827; see the type material section of the previous species for the deduction of the locality of this specimen, Fig. 17d) [MFNB] .</p><p>Type locality. French Guiana: Roura, Galion .</p><p>Etymology. In Latin, latitudinum differentia means "difference in width," referring to the widths of the discal (broader) and submarginal (narrow) bands: lati [tudinum]+ dif [ferenti] a. The name is an adjective.</p><p>Distribution. Lower Amazonian region; recorded from Brazil: Pará and French Guiana.</p></div>	https://treatment.plazi.org/id/C45B002EFFF8FF9AE1FBABAB7490309B	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFF9FF95E251AC647546339C.text	C45B002EFFF9FF95E251AC647546339C.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	(Astria) Zhang & Cong & Shen & Song & Grishin 2024	<div><p>Astria Grishin, new subgenus</p><p>http://zoobank.org/ 132F96BD-9572-444E-A4F8-D2E0D21ED23B</p><p>Type species. Lycaena astraea Freyer, 1851 .</p><p>Definition. Nuclear genome phylogeny reveals that Glaucopsyche astraea (Freyer, 1851) (type locality in Turkey, syntype sequenced as NVG-22119A10) is sister to all other species of Glaucopsyche Scudder, 1872 (type species Polyommatus lygdamus E. Doubleday, 1841), including type species of all its subgenera and their available synonyms: Polyommatus lygdamus E. Doubleday, 1841 of Glaucopsyche Scudder, 1872; Lycaena catalina Reakirt, 1866 (a junior subjective synonym of Lycaena piasus Boisduval, 1852) of Phaedrotes Scudder, 1876; Polyommatus melanops Boisduval, 1828 of Apelles Hemming, 1931; Glaucopsyche (Sinia) leechi Forster, 1940 of Sinia Forster, 1940; Lycaena barine Leech, 1893 (a subspecies of Lycaena divina Fixsen, 1887) of Shijimiaeoides Beuret, 1958; and Lycaena argali Elwes, 1899 of Bajluana Korshunov, 1990 (Fig. 18a). We note that Phaedrotes (a subgenus of G. piasus) that causes problems by rendering Glaucopsyche paraphyletic in trees inferred from a small number of gene markers, especially when using a larger fraction of positions from mitochondrial genes (Nazari et al. 2024) or complete mitogenomes (Fig. 18b), is closer related (with 100% statistical support) to the subgenus Glaucopsyche than G. astraea . In agreement with morphological considerations, Glaucopsyche is monophyletic in the nuclear genome tree, with G. astraea being its most divergent member. Therefore, G. astraea is not monophyletic with any described subgenera of Glaucopsyche and does not belong to any of them. Hence, its lineage represents a new subgenus. This new subgenus differs from its relatives by ventrally not darkened marginal area and submarginal spots in forewing cells M 3 -CuA 1 and CuA 1 -CuA 2 being closer to the margin than in other species and forming a line nearly parallel to the outer margin, while the other three spots of the band are in a straight line with each other and the 4 th spot (in cell M 3 - CuA 1), i.e., the spot nearest to costa is not offset from the rest. In DNA, a combination of the following characters is diagnostic in the nuclear genome: cce62262.1.1:A120T, cce62262.1.1:C123T, cce748.19.2: C39T, cce748.19.2:T78C, cce 2404.9.1:C165T and in COI barcode: A34T, A94T, T448C, T484C, T598C.</p><p>Etymology. The name of the type species likely refers to Astraea (Ἀστραῖα), a Greek goddess of justice, innocence, purity, and precision. A different spelling of this name ( Astria) is taken as the genus name, which is a feminine noun in the nominative singular.</p><p>Species included. Only the type species (i.e., Lycaena astraea Freyer, 1851).</p><p>Parent taxon. Genus Glaucopsyche Scudder, 1872 .</p><p>Comment. Glaucopsyche is an example of confident incongruence between nuclear and mitochondrial genomes (Fig. 18a vs. b) with subgenera Phaedrotes and Astria subgen. n. not being in the same clade as the rest of the genus in the mitogenomic tree, probably due to mitochondrial introgression. Further studies of this incongruence will shed light on the role of hybridization in speciation and adaptation.</p></div>	https://treatment.plazi.org/id/C45B002EFFF9FF95E251AC647546339C	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFF6FF94E0F9ACA27362372C.text	C45B002EFFF6FF94E0F9ACA27362372C.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Oraidium Bethune-Baker 1914	<div><p>Oraidium Bethune-Baker, 1914 is a subgenus of Brephidium Scudder, 1876</p><p>Genomic analysis of all valid species of Oraidium Bethune-Baker, 1914 (type species Lycaena barberae Trimen, 1868) and Brephidium Scudder, 1876 (type species Lycaena exilis Boisduval, 1852), including all but one subspecies, reveals three groups that are approximately equidistant from each other genetically (Fig. 19 blue, purple, and red). Moreover, as the nuclear tree from autosomal codons suggests, Brephidium may be paraphyletic with respect to Oraidium, and the two African species of the group form Similar, although less confident, grouping is seen in the mitochondrial genome tree (Fig. 19c). The COI barcode difference between the type species of Oraidium and Brephidium is 6.1% (40 bp), compared to somewhat larger difference between Brephidium metophis (Wallengren, 1860) and Brephidium exilis (Boisduval, 1852) of 8.1% (53 bp), also indicating approximately equal distance between these three species (Fig. 19). These results may reflect the actual relationship, implying fast evolution in genitalia of Oraidium, or caused by more frequent introgression between African species that resulted in convergent overall genetic similarity. Regardless of the evolutionary scenario, we do not see strong genomic support for maintaining Oraidium as a distinct genus. Moreover, the two African species, B. metophis and O. barberae, are quite similar to each other in wing patterns and are frequently misidentified (iNaturalist 2023). Nevertheless, Oraidium possesses distinct genitalia (Bethune-Baker 1914; Stempffer 1967), and instead of synonymizing it with Brephidium, we propose to treat Oraidium Bethune-Baker, 1914, stat. nov. as a subgenus of Brephidium Scudder, 1876 .</p></div>	https://treatment.plazi.org/id/C45B002EFFF6FF94E0F9ACA27362372C	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFF7FF94E23FA98C736032BC.text	C45B002EFFF7FF94E23FA98C736032BC.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	(Afroidium) Zhang & Cong & Shen & Song & Grishin 2024	<div><p>Afroidium Grishin, new subgenus</p><p>http://zoobank.org/ 8FC2EE60-CF08-4749-83C9-A772D99E42D0</p><p>Type species. Lycaena metophis Wallengren, 1860 .</p><p>Definition. As genomic analysis demonstrates, all species of Oraidium Bethune-Baker, 1914 (type species Lycaena barberae Trimen, 1868) and Brephidium Scudder, 1876 (type species Lycaena exilis Boisduval, 1852) (Fig. 19) partition into three groups approximately equidistant from each other (Fig. 19). Above, we proposed to treat Oraidium as a subgenus of Brephidium, which may render Brephidium paraphyletic (Fig. 19). To avoid possible non-monophyletic taxa, the third groups should also be given a rank of subgenus. This new subgenus differs from Oraidium by its aedeagus, which is not saddle-shaped in its internal part but is bulbous, and the external part is similar to a small beak (shorter than the internal part) and not divided into two long (about twice the length of the internal part in O. barberae) and slender processes; and from both Oraidium and Brephidium by the tegumen lobe, which is with the terminal process not as long and rod-like as in Oraidium, and is broader and bulkier than in Brephidium, terminally with five shorter bristles (not two longer ones), and the base dorsally with a hump (not a lobe as in Oraidium and not a hook-like process with sharp small teeth as in Brephidium). For further details about the morphology of these species and illustrations of their genitalia see Bethune-Baker (1914) and Stempffer (1967). In DNA, a combination of the following characters is diagnostic in the nuclear genome: cce22066.7.13:A106C, cce462.35.4:G159A, cce10386.1.3:C46T, cce 1353.3.2:A63T, cce 2452.1.6:C78T and in COI barcode: A88T, T127C, T163A, A202G, T616C.</p><p>Etymology. The name reflects the Afrotropical distribution of this subgenus and is formed similarly to Brephidium and Oraidium: Afro [tropical Breph] idium. The name is a neuter noun in the nominative singular.</p><p>Species included. Only the type species (i.e., Lycaena metophis Wallengren, 1860).</p><p>Parent taxon. Genus Brephidium Scudder, 1876 .</p></div>	https://treatment.plazi.org/id/C45B002EFFF7FF94E23FA98C736032BC	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFF4FF97E103AAE6725B3187.text	C45B002EFFF4FF97E103AAE6725B3187.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Lycaena sissona W. G. Wright 1905	<div><p>Lycaena sissona W. G. Wright, 1905 is a junior subjective synonym of Cupido comyntas (Godart, [1824])</p><p>Genomic sequencing of two syntypes of Polyommatus comyntas Godart, [1824] (type locality in North America; NVG-23027C03 and NVG-23027C04) in the Muséum National d'Histoire Naturelle, Paris, France (MNHP) reveals that contrary to the current interpretation they are not monophyletic with specimens from the eastern USA (Fig. 20 green), but instead are in the same clade with specimens from California (Fig. 20 purple), together with the lectotype of Lycaena sissona W. G. Wright, 1905 currently treated as a valid subspecies, Cupido comyntas sissona, as proposed by Austin (2002). The same relationship is observed in both nuclear and mitochondrial genome trees (Fig. 20a and b), not revealing introgression scenarios that are commonly encountered in closely related groups of populations and even species. Moreover, specimens of Cupido comyntas texana (F. Chermock, 1945) form a clade of their own (Fig. 20 blue), thus confirming the validity of this subspecies distributed from southern Texas to Panama. However, specimens collected in the San Antonio area more recently than the type series of C. comyntas texana (1992 vs. 1920) (Fig. 20 labeled in cyan) partition into the two clades and may be intergrades between the eastern and southern subspecies.</p><p>As a result of the genomic analysis, we suggest that the type locality of P. comyntas Godart is likely in California and not in the eastern USA, and propose that Lycaena sissona W. G. Wright, 1905, syn. nov. is a junior subjective synonym of Cupido comyntas (Godart, [1824]) . Visual assessment of the syntypes’ wing pattern agrees with this conclusion: the ventral forewing nearly lacks marginal and submarginal spots towards the apex, and white framing of dark ventral spots is weakly defined. These characters were mentioned by Austin (2002) to distinguish C. comyntas sissona from other subspecies. To stabilize nomenclature, N.V.G. hereby designates one of the two syntypes in MNHP, a male, bearing the following six rectangular labels, 1 st red, 4 th green, and others white: [TYPE], [comyntas, god. | ♂], [ EVERES | COMYNTAS GOD.], [MUSÉUM PARIS], [DNA sample ID: | NVG-23027C04 | c/o Nick V. Grishin], and [MNHN, Paris | EL83734 {QR code}] as the lectotype of Polyommatus comyntas Godart, [1824] . The style and handwriting on the second label are characteristic of Godart’s type specimens, confirming this specimen as a syntype. The lectotype has a small nick at the apex of the right forewing and its head is rotated to the right.</p></div>	https://treatment.plazi.org/id/C45B002EFFF4FF97E103AAE6725B3187	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFF5FF91E14FAA1F74B73162.text	C45B002EFFF5FF91E14FAA1F74B73162.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Cupido (Everes) comyntas subsp. orientalis Zhang & Cong & Shen & Song & Grishin 2024	<div><p>Cupido (Everes) comyntas orientalis Grishin, new subspecies</p><p>http://zoobank.org/ 7169288F-1A58-4B26-8776-F2566A73DB1B</p><p>(Figs. 20 part, 21)</p><p>Definition and diagnosis. As detailed above, the nominate Cupido comyntas (Godart, [1824]) is the western subspecies with a likely type locality in California. As a result, no available name applies to the eastern USA subspecies formerly known as “ Cupido comyntas comyntas ”. Only two names, both infrasubspecific, have been proposed for the eastern US populations. Everes comyntas ab. watermani Nakahara, 1926 (from New York, Tompkins Co., Ithaca) is infrasubspecific according to the ICZN Art. 45.6.2 because it refers to an aberration ("ab.") (ICZN 1999). Everes comyntas f. meinersi W. D. Field, 1938 (from Kansas. Douglas Co. Lawrence) is infrasubspecific because, in accord with the ICZN Art. 45.6.4, the “author expressly used … "f."” and “also expressly gave it infrasubspecific rank” by stating that “This is the spring brood” (Field 1938). According to the ICZN Glossary, “infrasubspecific entity” refers to “Specimen(s) within a species differing from other specimens in consequence of intrapopulation variability … (e.g. … seasonal forms, … or … differing generations)” (ICZN 1999). The spring brood is a different generation within a species and a seasonal form. Furthermore, the name meinersi has not been used as a valid name for a species or subspecies (Art. 45.6.4.1). Therefore, the eastern US subspecies of C. comyntas is new and is described here.</p><p>The eastern subspecies (Fig. 20 green) is genetically differentiated from the nominate C. comyntas, which forms a clade sister to other populations (Fig. 20 purple), and the COI barcode difference between the western and eastern subspecies is 0.6% (4 bp). The eastern subspecies is closer genetically to the southern Cupido comyntas texana (F. Chermock, 1945) (type locality USA: Texas, Bexar Co., near San Antonio) (Fig. 20 blue), but forms a clade distinct from it (Fig. 20 green), although their COI barcodes generally do not differ but by one or two base pairs. This new subspecies differs from other C. comyntas subspecies by the following characters: darker and browner (vs. grayer) ventral side of wings with more distinct whitish framing of dark spots; typically a complete row of marginal and submarginal spots beneath, particularly on the forewing (these spots are usually poorly expressed or lacking towards the apex in other subspecies); and brighter orange (vs. paler and yellower) ventral hindwing tornal crescents (Fig. 21). See further details in Austin (2002), who referred to C. comyntas comyntas by the name of its junior subjective synonym, sissona, and to the new subspecies as “ comyntas comyntas .” A combination of the following DNA characters is diagnostic in the nuclear genome: cce 2265.4.2:G66A, cce 2896.5.6:A57G, cce 2896.5.6:T84G, cce13103.2.4:C74T, cce13103.2.4:C59A and in COI barcode differs from the nominate subspecies by: 412A, 508T, 556A, 641T (COI barcodes do not generally differ from C. comyntas texana).</p><p>AACATTATATTTTATTTTTGGAATTTGAGCAGGAATATTAGGAACATCTTTAAGAATCTTAATTCGAATAGAATTAGGAACTCCAGGCTCATTAATTGGAGATGATCAAATTTATAATACT ATTGTCACAGCTCATGCTTTTATTATAATTTTTTTCATAGTAATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTACCATTAATATTAGGTGCTCCAGATATAGCATTTCCTCGAA TAAATAATATAAGATTTTGATTATTACCTCCATCATTAATATTATTAATTTCAAGAAGAATCGTAGAAAATGGAGCAGGAACAGGATGAACAGTGTACCCCCCACTTTCATCAAATATTGC CCATGGAGGATCATCTGTAGATTTAGCAATTTTTTCTTTACATTTAGCAGGAATCTCTTCAATTTTAGGAGCAATTAATTTTATTACAACTATTATTAATATACGAGTTAATAATTTATCA TTTGATCAAATATCTCTATTTATTTGAGCTGTAGGAATTACAGCATTATTATTATTATTATCATTACCTGTATTAGCTGGGGCTATTACAATATTATTAACTGATCGAAATTTAAATACCT CATTTTTTGATCCTGCTGGAGGAGGAGACCCAATCTTATATCAACATTTATTT</p><p>Type material. Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity, Florida Museum of Natural History, Gainesville, FL, USA [MGCL], illustrated in Fig. 21, bears five printed labels: four white [NC: Mecklenburg Co. | Charlotte, W. Arrowood Rd &amp; | Green Ridge Dr, near Sugar Creek May 20, 2022 | Leg: W. Dempwolf], [ Cupido comyntas | ♂ | Coll of: W R Dempwolf], [DNA sample ID: | NVG-22058F01 | c/o Nick V. Grishin], [WRD 20,914], and one red [HOLOTYPE ♂ | Cupido comyntas | orientalis Grishin]. Paratypes: 6♂♂ and 4♀♀ from USA: 1♂ Virginia, Rockingham Co., Briery Branch Rd., 7.3 mi WNW Briery Branch, GPS 38.4734, −79.2042, 07-May-2016, N. V. Grishin &amp; Q. Cong leg. (NVG-6090); 1♀ Indiana, Montgomery Co., Shades State Park, 39.9312, −87.0666, N. V. Grishin, 1-Aug-2015 (NVG-4239); 1♂ Arkansas, Montgomery Co., Ouachita National Forest, Big Brushy Creek, along NF6, GPS 34.6589, −93.8345, 4-Jul-2015, N. V. Grishin leg. (NVG-3888); 1♂ Oklahoma, Atoka Co., McGee Creek, GPS 34.3737, −95.8886, 11-Jul-2017, N. V. Grishin leg. (NVG-9270); and Texas: 1♀ Marion Co., Caddo Lake region, along SH43, GPS 32.7957, −94.1755, 20- Jun-2015, N. V. Grishin leg. (NVG-3694); 1♂ Wise Co., LBJ National Grassland, Cottonwood Lake, GPS 33.3828, −97.5719, 19-Jul-2015, N. V. Grishin leg. (NVG-4182); 1♀ Hardin Co, 4.4 mi SW Kountze, along FM 770, GPS 30.3389, −94.3678, 7-Jun-2015, N. V. Grishin leg. (NVG-3506); Travis Co., Barton Creek Greenbelt, Camp Craft Road entrance, 28-Mar-2016, W. R. Dempwolf, leg.: 1♂ (NVG-22088H04, WRD 9243) and 1♀ (NVG-22088H05, WRD 9244); and 1♂ Blanco Co., USH281 ca. 1 mi N of USH290, 3-Oct-2015, W. R. Dempwolf, leg. (NVG-22088H03, WRD 3649).</p><p>Type locality. USA: North Carolina, Mecklenburg Co., Charlotte, W. Arrowood Rd. and Green Ridge Dr. near Sugar Creek .</p><p>Etymology. In Latin, orientalis means eastern. This way, the eastern Eastern Tailed Blue gets its eastern name. The name is an adjective.</p><p>Distribution. In the eastern half of the USA, southwards to central Texas and Florida.</p></div>	https://treatment.plazi.org/id/C45B002EFFF5FF91E14FAA1F74B73162	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFF2FF90E10BAECD73FF3494.text	C45B002EFFF2FF90E10BAECD73FF3494.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Albulina Tutt 1909	<div><p>Albulina Tutt, 1909 is a genus distinct from Agriades Hübner, [1819]</p><p>Genomic phylogeny of Agriades Hübner, 1819 (type species Papilio glandon Prunner, 1798) and relatives reveals nuclear-mitochondrial incongruence (Fig. 22). Papilio orbitulus de Prunner, 1798, a valid name for the type species of Albulina Tutt, 1909 (type species Papilio pheretes Hoffmansegg, 1804, a replacement name for Papilio atys Hübner, [1804], regarded as a junior subjective synonym of P. orbitulus), currently in the genus Agriades, is indeed placed within Agriades in the mitochondrial genome tree (Fig. 22c magenta and green). However, nuclear genome trees (both autosomes Fig. 22a and the Z tree shows strong statistical support for the lack of monophyly (Fig. 22b). We consider that the nuclear genome represents the organism, and the mitochondrial genome is more prone to evolutionary irregularities such as introgression and possibly complete replacement by a mitogenome of a relative. Therefore, Agriades is not monophyletic if it includes A. orbitulus . To restore the monophyly of Agriades, we propose to treat Albulina Tutt, 1909, stat. rev. as a genus distinct from Agriades Hübner, [1819] . The example of nuclear-mitochondrial incongruence in Agriades - Albulina is remarkable in its taxonomic significance and should be investigated further in more detail.</p></div>	https://treatment.plazi.org/id/C45B002EFFF2FF90E10BAECD73FF3494	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFF3FF90E171A93B7532315F.text	C45B002EFFF3FF90E171A93B7532315F.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	(Arianna) Zhang & Cong & Shen & Song & Grishin 2024	<div><p>Arianna Bálint, 2022 is a subgenus of Plebejus Kluk, 1780</p><p>Originally proposed as a genus, Arianna Bálint, 2022 (type species Lycaena eversmanni H. C. Lang, 1884) originates within Plebejus Kluk, 1780 (type species Papilio argus Linnaeus, 1758) rendering it polyphyletic (Fig. 22). Willing to neither split Plebejus into several genera nor synonymize Arianna, we propose to treat Arianna Bálint, 2022, stat. nov. as a subgenus of Plebejus Kluk, 1780 . Some other related genera are likely to become subgenera of Plebejus after their genomic data are analyzed.</p></div>	https://treatment.plazi.org/id/C45B002EFFF3FF90E171A93B7532315F	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFF3FF90E232AEEA723932B7.text	C45B002EFFF3FF90E232AEEA723932B7.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Hesperiidae Latreille 1809	<div><p>Family Hesperiidae Latreille, 1809</p><p>Genomic phylogeny of Euriphellus Austin, 2008</p><p>Four new species of Euriphellus Austin, 2008 (type species Papilio euribates Stoll, 1782) have been recently proposed: E. panamicus Grishin, 2023 (type locality in Panama: Panama), E. panador Grishin, 2023 (type locality in Ecuador: Esmeraldas), E. colombiensis Grishin, 2023 (type locality in Colombia: Río Dagua), and E. ecuadoricus Grishin, 2023 (type locality in Ecuador: Canelos) (Zhang et al. 2023a; Zhang et al. 2023d), but not all of them have been included together in the same phylogenetic tree. Here we show genome-based phylogeny of all known Euriphellus species (Fig. 23). The genus partitions into two distinct clades: the E. euribates group that consists of three species: E. cebrenus (Cramer, 1777) (type locality in Suriname), E. euribates (Stoll, 1782) (type locality in Suriname), and E. polygius (Latreille, [1824]) (type locality in South Brazil, as deduced by genomic sequencing) and the E. phraxanor group that includes all other species. Euriphellus cebrenus and E. euribates could be conspecific (Zhang et al. 2022b) pending further research and possible neotype designations. We find that the three trees are incongruent in the E. phraxanor group. However, the topology of the Z chromosome tree is not strongly supported (Fig. 23b). Most notable irregularities are in the mitochondrial genome tree (Fig. 23c): E. panador and E. colombiensis essentially share the mitochondrial DNA, despite not being sisters in the nuclear genome, and E. lama (Evans, 1952) (type locality in Guatemala) is similar to them while being a more distant species according to the nuclear genome. Comparing the topologies of the three trees, we hypothesize that E. colombiensis and E. lama experienced mitochondrial DNA introgression from E. panador but at different time points.</p></div>	https://treatment.plazi.org/id/C45B002EFFF3FF90E232AEEA723932B7	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFF3FF90E108ABA4719B3632.text	C45B002EFFF3FF90E108ABA4719B3632.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Vacciniina Tutt 1909	<div><p>Vacciniina Tutt, 1909 is a valid subgenus of Agriades Hübner, [1819]</p><p>Vacciniina Tutt, 1909 (type species Papilio optilete Knoch, 1781) is currently treated as a junior subjective synonym of Albulina Tutt, 1909 (type species Papilio pheretes Hoffmansegg, 1804, a replacement name for Papilio atys Hübner, [1804], regarded as a junior subjective synonym of Papilio orbitulus de Prunner, 1798), is not monophyletic with it, and instead remains in the genus Agriades Hübner, 1819 (type species Papilio glandon Prunner, 1798) (Fig. 22). Currently, A. optilete is assigned to a subgenus different from the nominotypical. To keep this hierarchy, we propose that Vacciniina Tutt, 1909, stat. rest. is a valid subgenus. This view is consistent with higher genetic differentiation of A. optilete from other Agriades .</p></div>	https://treatment.plazi.org/id/C45B002EFFF3FF90E108ABA4719B3632	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFF1FFADE1BEA8AE737C3009.text	C45B002EFFF1FFADE1BEA8AE737C3009.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Heliopetes (Heliopetes) acuta Zhang & Cong & Shen & Song & Grishin 2024	<div><p>Heliopetes (Heliopetes) acuta Grishin, new species</p><p>http://zoobank.org/ E7DBBCD3-4C99-4421-B3AB-D755D72CD7F3</p><p>(Figs. 24 part, 25)</p><p>Definition and diagnosis. Genome-based phylogeny places one specimen from Oaxaca, Mexico, tentatively identified by us as Heliopetes (Heliopetes) lana Grishin, 2023 (type locality in Guatemala) as sister to the clade of three species: H. lana, Heliopetes alana (Reakirt, 1868) (type locality in Colombia), and Heliopetes chimbo Evans, 1953 (type locality in Ecuador) (Fig. 24) and, therefore, represents a species distinct from them. The COI barcode of the new species differs by 2.1% (14 bp) from H. lana, 1.7% (11 bp) from H. alana, and 1.8% (12 bp) from H. chimbo . Curiously, the geographically closest and possibly sympatric H. lana has the COI barcode most different from the new species. This new species keys to H. alana (G.2.12) in Evans (1953) and differs from its relatives by better defined and larger pale triangles with sharper points at the outer margin of the ventral forewing, particularly at the apex, and brownish gray anal fold on the dorsal hindwing (typically white in H. lana and H. alana) (Fig. 25). Because the phenotypic variation of this species has not been explored, definitive identification is provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome: aly 2532.4.3:A174G, aly 2532.4.3:T345A, aly 2532.4.3:C360T, aly 2532.4.3:A363G, aly 2633.1.13:T141C, aly259.26.1:C599C (not G), aly259.26.1:T619T (not C), aly235.14.1:C2784C (not T), aly235.14.1:A2829A (not G), aly1603.14.1:A294A (not G) and in COI barcode: C3T, C133T, T178T, T235T, T376A, C610T, T613T.</p><p>Barcode sequence of the holotype: Sample NVG-22105D09, GenBank PP254258, 658 base pairs: AATTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGTACTTCTTTAAGTTTATTAATTCGAACTGAATTAGGAAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTCATAGTAATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATATTAGGAGCCCCAGATATAGCATTTCCTCGTA TAAATAATATAAGATTTTGACTTTTACCCCCATCCCTAACATTATTAATTTCAAGAAGTGTAGTAGAAAATGGAGCAGGAACTGGTTGAACAGTTTACCCCCCTCTCTCGGCTAATATCGC CCATCAAGGATCATCTGTTGATTTAGCTATTTTTTCTTTACATTTAGCTGGAATTTCATCTATCTTAGGAGCTATTAATTTTATTACAACTATTATTAATATACGTATTAGAAATATATCA TTTGACCAAATACCTTTATTTGTATGAGCAGTAGGAATTACTGCTTTATTACTACTATTATCATTACCTGTTTTAGCAGGTGCTATTACAATATTATTAACAGATCGAAATTTAAATACAT CATTTTTTGATCCTGCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTC</p><p>Type material. Holotype: ♂ deposited in the California Academy of Sciences, San Francisco, CA, USA [CAS], illustrated in Fig. 25, bears seven printed (dates and the species name on the 4 th label handwritten): six white [MEX.: Oaxaca, | Candelaria Loxicha | 500 m; IX-15-73], [rec’d from | P. Hubbell], [Collection of | C. D. MacNeill], [ Heliopetes | alana (Reak.) | Det. C.D. MacNeill '75], [DNA sample ID: | NVG-22105D09 | c/o Nick V. Grishin], [{QR Code} CASENT | 8568387], and one red [HOLOTYPE ♂ | Heliopetes (Heliopetes) | acuta Grishin].</p><p>Type locality. Mexico: Oaxaca, Candelaria Loxicha .</p><p>Etymology. In Latin, acutus means sharp, pointed, or keen, from which we form the noun acuta and use it in apposition. The name refers to sharp and pointed marginal white triangles on the ventral forewing of this species.</p><p>Distribution. Known only from Oaxaca in Mexico.</p></div>	https://treatment.plazi.org/id/C45B002EFFF1FFADE1BEA8AE737C3009	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFCEFFAFE1A5AF31747E3734.text	C45B002EFFCEFFAFE1A5AF31747E3734.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Gerosis cnidus (Plotz 1884)	<div><p>Gerosis cnidus (Plötz, 1884) is a species distinct from Gerosis phisara (Moore, 1884), with revised synonymy</p><p>Inspecting Hesperiidae holdings in MFNB, we found a syntype of Achlyodes cnidus Plötz, 1884 (type locality not specified), currently regarded as a junior subjective synonym of Gerosis phisara (Moore, 1884) (type locality in India: Assam, Khasi Hills). According to its labels (Fig. 26b), this specimen shown in Fig. 26a was identified as cnidus by Plötz (“best[immt]. v[on]. Plötz”). This identification label was added to the specimen before the publication because it cited an unpublished name (“i[n]. l[itteris]”). The specimen is from the Weymer collection that contains primary types of many of Plötz’s names. The specimen agrees with the original description and Godman’s copy of the unpublished illustration by Plötz (Fig. 26c). Because this is a rarely encountered phenotype of Gerosis, it is possible that it was the only specimen known to Plötz, and the specimen illustrated. Godman’s copies appear rather sketchy and not particularly detailed (it remains unclear whether the originals were more detailed), and the agreement between the illustration (Fig. 26c) and the specimen (Fig. 26a) is reasonable.</p><p>To stabilize nomenclature, N.V.G. hereby designates the specimen in MFNB shown in Fig. 26a, a male, bearing the following five rectangular white labels, 3 rd and 5 th printed, others handwritten: [cnidus NVG-21115E07 | c/o Nick V. Grishin] as the lectotype of Achlyodes cnidus Plötz, 1884 . The lectotype has a fingerprint mark at the left forewing apex and is missing a part of the right hindwing fringe towards the tornus. The number 161 likely refers to the Weymer collection, and we were not able to associate it with any published information. The label 75:5 gives a genus number (75 - Gindanes) and a species number (5 - cnidus) in the Mabille catalog (Mabille 1903) that was used as a guide to arranging the Hesperiidae collection in Berlin. The type locality that was not specified in the original description and not given on the lectotype labels remains unknown and will eventually be deduced by genomic sequencing and comparison with G. cnidus specimens from known localities.</p><p>Genomic sequencing of the A. cnidus lectotype does not place it close to G. phisara but instead revealed that it is distant from other Gerosis Mabille, 1903 (type species Coladenia hamiltoni Nicéville, 1889, currently treated as a junior subjective synonym of Satarupa phisara (Moore, 1884) (Fig. 27). Therefore, we propose that Gerosis cnidus (Plötz, 1884), stat. rest. is a valid species distinct from Gerosis phisara (Moore, 1884) in particular, and from other Gerosis in general. Because we sequenced only one specimen of Gerosis cnidus, it remains unclear whether its unique for Gerosis wing pattern is an aberration as suggested by Evans (1949) or a color morph (in which case the typical striped and spotted form has not been found yet), or represents the typical (and the only?) wing pattern form of this species.</p><p>Although we have not sequenced type specimens of Coladenia hamiltoni Nicéville, 1889 (type locality in Bangladesh: Sylhet) and Caprona? kuki Tytler, 1915 (type locality in India: Lushai Hills), due to their wing pattern similarity with G. cnidus, we propose to treat them as its junior subjective synonyms instead of keeping them as synonyms of Gerosis phisara, pending further research. As a result of this analysis, the valid name for the type species of Gerosis becomes Gerosis cnidus (Plötz, 1884), stat. rest., and we hypothesize that its type locality is in eastern India or Bangladesh. If the wing pattern of G. cnidus represents an unusual color morph, this morph may be present in other species of Gerosis, in which case C. hamiltoni and/or C. kuki might be some species other than G. cnidus .</p></div>	https://treatment.plazi.org/id/C45B002EFFCEFFAFE1A5AF31747E3734	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFCCFFAEE203A83B74653380.text	C45B002EFFCCFFAEE203A83B74653380.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Metrocles Godman 1900	<div><p>Metrocles nun Grishin, new species</p><p>http://zoobank.org/ 40F78E1E-A010-4A7C-83CD-A1B5C9DFBBE1 (Figs. 28 part, 29, 30a)</p><p>Definition and diagnosis. Genomic analysis of an unusually patterned specimen from Goiás Brazil (Fig. 29) somewhat resembling Metrocles schrottkyi (Giacomelli, 1911) (type locality in Argentina) (Fig. 30b) in its wing pattern and a tri-partite brand that is nearly shaped into a stigma, places it in Metrocles Godman, 1900 (type species Metrocles leucogaster Godman, 1900) sister to Metrocles argentea (Weeks, 1901) (type locality in Bolivia) (Fig. 28). This specimen represents a new species that differs from all similar species by a combination of a nearly straight white discal band on reddish-brown ventral hindwing with its white inner margin that continues along the sides of the thorax, behind the eyes and onto the collar, thus forming a continuous hairpin-shaped white framing from tornus of one hindwing to the other, and the lack of white spots in the forewing discal cell. Metrocles schrottkyi lacks this white hairpin framing. In DNA, a combination of the following characters is diagnostic in the nuclear genome: aly 2850.3.4:C63T, aly103.44.1:C60T, aly 1591.7.3:T331C, aly127.37.1:G699A, aly127.37.1:C721A, aly2850. 3.4:C75C (not T), aly6398.4.4:G66G (not A), aly6398.4.4:C72C (not G), aly499.16.2:C159C (not T), aly3268. 8.1:C138C (not T) and in COI barcode: T49C, T197C, T235C, T529A, T595C.</p><p>Barcode sequence of the holotype. Sample NVG-18117A01, GenBank PP254259, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCCCTAAGATTATTAATTCGAACTGAATTAGGAGCTCCTGGATCATTAATTGGAGATGATCAAATTTATAATACT ATTGTTACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGACTAGTTCCTTTAATATTAGGAGCTCCTGATATAGCATTCCCTCGAA TAAATAATATAAGATTTTGAATATTACCCCCATCATTAACTTTATTAATTTCTAGAAGAATTGTAGAAAATGGTGCAGGTACTGGTTGAACAGTTTATCCTCCTTTATCTTCTAATATTGC CCATCAAGGATCTTCTGTTGATTTAGCAATTTTTTCACTTCATTTAGCTGGTATCTCATCAATCTTAGGAGCTATTAACTTTATCACAACAATTATTAATATACGAATTAGAAATATATCA TTTGATCAAATACCTTTATTTGTATGATCTGTAGGAATTACAGCATTATTATTACTTTTATCTTTACCTGTTCTAGCTGGAGCTATTACTATATTACTTACTGATCGAAACTTAAATACTT CATTTTTTGATCCTGCTGGAGGAGGTGATCCTATTTTATATCAACATTTATTT</p><p>Type material. Holotype: ♂ currently deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA [USNM], illustrated in Fig. 29, bears seven printed labels (text in italics handwritten): six white [24 kil. E. Formoso, | Go., Brazil | May 16, 1956 | F. S. Truxal], [MACHRIS BRAZILIAN | EXPEDITION – 1956 | LOS ANGELES | COUNTY MUSEUM], [genitalia | slide/vial # | H 78 | Prep. S.S. Nicolay], [ Chalcone | zisa ♂ | Det. Plotz | S.S. Nicolay], [DNA sample ID: | NVG-18117A01 | c/o Nick V. Grishin], [USNMENT | {QR Code} | 01531662], and one red [HOLOTYPE ♂ | Metrocles | nun Grishin].</p><p>Type locality. Brazil: Goiás, 24 km east of Formoso .</p><p>Etymology. A resting individual of this species, with its dark color and white framing from collar to tornus, resembles a nun (Fig. 30a), hence the name, which is a noun in apposition.</p><p>Distribution. Currently known from Central Brazil.</p><p>Comments. Although we have not yet sequenced M. schrottkyi (Fig. 30b), querying the BOLD database (Ratnasingham and Hebert 2007) with COI barcodes of our sequenced specimens reveals that it is a species different from either Metrocles scitula (Hayward, 1951) (type locality in Brazil: Mato Grosso) and this new species, although closely related to them (~2.5% difference).</p></div>	https://treatment.plazi.org/id/C45B002EFFCCFFAEE203A83B74653380	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFCDFFA8E214ACBC75263145.text	C45B002EFFCDFFA8E214ACBC75263145.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Hedone miracla Zhang & Cong & Shen & Song & Grishin 2024	<div><p>Hedone miracla Grishin, new species</p><p>http://zoobank.org/ 81924866-9D81-4CAF-AA05-4BCC49DAF282</p><p>(Figs. 31 part, 32)</p><p>Definition and diagnosis. Genomic analysis of Hedone Scudder, 1872 (type species Hesperia brettus Boisduval &amp; Le Conte, [1837], a junior subjective synonym of Thymelicus vibex Geyer, 1832) reveals that a female collected north of Lima in Peru is sister to Hedone mira Grishin &amp; Lamas, 2022 (type locality in Peru: Apurímac) but is genetically differentiated from it at the species level (Fig. 31), e.g., their COI barcodes differ by 2.4% (16 bp). Therefore, this female represents a new species. This new species differs from other Hedone species (except H. mira) by rusty-colored ventral hindwing with a yellowish broken discal band and only slightly scalloped dark outer border of forewing, and differs from H. mira by redder and broader (but not as broad and continuous as in Hedone bittiae (Lindsey, 1925), type locality in Peru) discal band on ventral hindwing, more diffuse marginal brown on dorsal hindwing blending with orange ground color, smaller forewing subapical spots, and submarginal spots more offset towards the forewing margin. Due to unexplored phenotypic variation, definitive identification is provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome: aly103.11.2:C760T, aly103.11.2:A1569G, aly159.18.1:T114A, aly159.18.1:C198T, aly499.1.3:G42A, aly1487.2.21:G57G (not A), aly 1487.2.21:C60C (not A), aly577.49.5:A174A (not G), aly331.3.6:C165C (not T), aly569.1.2:C109C (not T) and in COI barcode: T124C, T284C, T343A, T532A, T596C.</p><p>Barcode sequence of the holotype. Sample NVG-22102C03, GenBank PP254260, 658 base pairs: AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACTTCCTTAAGTTTATTAATTCGAACAGAATTAGGTAATCCTGGTTCTTTAATTGGAGATGATCAAATTTATAATACT ATCGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCATTAATATTAGGAGCTCCTGATATAGCTTTTCCTCGAA TAAATAACATAAGATTTTGAATATTACCTCCTTCACTAACACTATTAATTTCAAGAAGAATTGTAGAAAATGGTGTAGGAACAGGTTGAACAGTTTATCCACCTTTATCTTCTAATATTGC TCATCAAGGATCTTCTGTTGATTTAGCAATTTTTTCTCTTCATTTAGCTGGAATTTCTTCTATTTTAGGAGCTATTAATTTTATTACAACAATTATCAATATACGAATTAAAAATTTATCT TTTGATCAAATACCTTTATTTGTATGATCTGTTGGAATTACAGCTCTATTATTATTATTATCTTTACCTGTTTTAGCTGGAGCTATTACTATATTACTTACAGATCGAAATCTAAATACTT CTTTTTTTGATCCAGCTGGAGGAGGAGATCCAATCTTATATCAACATTTATTT</p><p>Type material. Holotype: ♀ currently deposited in the California Academy of Sciences, San Francisco, CA, USA [CAS], illustrated in Fig. 32, bears seven labels, 3 rd and 4 th handwritten (below, text in italics handwritten) and others printed: six white [Chancay, | PERU.III-15-51| River valley], [Ross and | Michelbacher | Collectors], [♀ 6113 | P. vibex ? | C. D. MACNEILL' 93], [ Polites vibex | bittiae ? LINDSEY | Det. C.D. MacNeill '93], [DNA sample ID: | NVG-22102C03 | c/o Nick V. Grishin], [{QR Code} CASENT | 8566975], and one red [HOLOTYPE ♀ | Hedone miracla | Grishin].</p><p>Type locality. Peru: Lima Department, ~ 80 km north of Lima, Chancay River valley .</p><p>Etymology. The name is formed from the sister species, H. mira, and is a noun in apposition.</p><p>Distribution. Currently known only from the holotype collected in coastal Peru north of Lima.</p></div>	https://treatment.plazi.org/id/C45B002EFFCDFFA8E214ACBC75263145	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFCBFFABE0A8AEE171D9344A.text	C45B002EFFCBFFABE0A8AEE171D9344A.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Punta Evans 1955	<div><p>Punta Evans, 1955 is a junior subjective synonym of Paracarystus Godman, 1900</p><p>Genomic phylogeny places Punta punta Evans, 1955 (type locality in Brazil: Pará), the type and the only species of Punta Evans, 1955, as a close sister to or even within Paracarystus Godman, 1900 (type species Cobalus hypargyra Herrich-Schäffer, 1869) (Fig. 33). Genetic differentiation between the two genera is low, e.g., COI barcodes of their type species differ by 6.1% (41 bp) and Punta does not stand out as a prominent separate lineage (Fig. 33). Therefore, we propose that Punta Evans, 1955, syn. nov. is a junior subjective synonym of Paracarystus Godman, 1900 .</p><p>Genomic comparison of subspecies of Vettius phyllus (Cramer, 1777) (type locality in Suriname) reveals that Vettius phyllus prona Evans, 1955 (type locality in Brazil: São Paulo) is genetically differentiated from others at the species level (Fig. 34), e.g., its COI barcode differs from the nominate V. phyllus by 2% (13 bp). Therefore, we propose that Vettius prona Evans, 1955, stat. nov. is a species distinct from Vettius phyllus (Cramer, 1777) .</p></div>	https://treatment.plazi.org/id/C45B002EFFCBFFABE0A8AEE171D9344A	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFC8FFABE16BA90672FC318C.text	C45B002EFFC8FFABE16BA90672FC318C.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Vettius pica (Herrich-Schaffer 1869)	<div><p>Vettius pica (Herrich-Schäffer, 1869) is a species distinct from Vettius lafrenaye (Latreille, [1824])</p><p>Genomic sequencing reveals that Vettius lafrenaye pica (Herrich-Schäffer, 1869) (type locality not specified) is genetically differentiated from Vettius lafrenaye lafrenaye (Latreille, [1824]) (type locality in Brazil) at the species level (Fig. 34), e.g., their Fst / Gmin statistics are 0.62/0.002, but the COI barcodes introgress between them, with the specimen from Costa Rica showing a difference of 1.5% (10 bp) from others. Therefore, we propose that Vettius pica (Herrich-Schäffer, 1869), stat. rest. is a species distinct from Vettius lafrenaye (Latreille, [1824]) .</p></div>	https://treatment.plazi.org/id/C45B002EFFC8FFABE16BA90672FC318C	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFC8FFAAE136AEB075633491.text	C45B002EFFC8FFAAE136AEB075633491.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Tigasis coda Evans 1955	<div><p>Tigasis coda Evans, 1955 belongs to the genus Gallio Evans, 1955</p><p>Genomic phylogeny of Moncina A. Warren, 2008 reveals that Tigasis coda Evans, 1955 (type locality in Ecuador) is not monophyletic with Tigasis Godman, 1900 (type species Tigasis zalates Godman, 1900) and instead originates within Gallio Evans, 1955 (type species Stomyles gallio Mabille, 1904, which is a junior subjective synonym of Vehilius carasta Schaus, 1902) and is sister to the clade consisting from Gallio garima (Schaus, 1902) (type locality in Trinidad) and Gallio massarus (E. Bell, 1940) (type locality in Brazil: Santa Catarina) (Fig. 35). Therefore, we place T. coda in the genus Gallio to form Gallio coda (Evans, 1955), comb. nov.</p><p>from Phlebodes fuldai (E. Bell, 1930)</p><p>Genomic sequencing and analysis reveal that Vettius yalta Evans, 1955 (type locality in Brazil: Espírito Santo) is genetically differentiated from Euroto fuldai Bell, 1930 (type locality in Colombia: Simiti), currently in the genus Phlebodes Hübner, [1819] (type species Papilio pertinax Stoll, 1781), at the species level (Fig. 36), e.g., their COI barcodes differ by 4.3% (28 bp). Therefore, we propose that Phlebodes yalta (Evans, 1955), stat. rest. is a species distinct from Phlebodes fuldai (E. Bell, 1930) .</p></div>	https://treatment.plazi.org/id/C45B002EFFC8FFAAE136AEB075633491	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Zhang, Jing;Cong, Qian;Shen, Jinhui;Song, Leina;Grishin, Nick V.	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
