taxonID	type	description	language	source
C45B002EFFEAFF88E22FAE76732D31EB.taxon	type_taxon	Type species. Papilio epidaus E. Doubleday, 1846. Definition. Genomic phylogeny that includes type species of all available genus-group names in Eurytides Hübner, [1821] (type species Eurytides iphitas Hübner, [1821]) reveals a lineage consisting of Eurytides epidaus (E. Doubleday, 1846) (type locality in Mexico (Yucatan) and Honduras) (Fig. 1 magenta) that is sister to the subgenus Mimoides K. Brown, 1991 (type species Papilio ariarathes Esper, 1788). The subgenus Boreographium Grishin, 2021 (type species Papilio marcellus Cramer, 1777) is sister to both Mimoides and the lineage with E. epidaus. To keep the classification monophyletic, this Mimoides, or a new subgenus should be erected for it. Mimoides, as originally circumscribed, includes species unified by certain recognizable appearance, and E. epidaus does not resemble this phenotype, having a different look (Fig. 2) more similar to Protesilaus W. Swainson, 1832 (type species	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFEAFF88E22FAE76732D31EB.taxon	description	Papilio protesilaus Linnaeus, 1758). Moreover, Mimoides is a genetically compact group (Fig. 1), and E. epidaus is separated from Mimoides by a prominent tree branch. The COI barcode difference between E. epidaus and E. ariarathes (the type species of Mimoides) is 6.8 % (45 bp), which is not atypical for species in different subgenera. For all these reasons, we propose to treat the lineage with E. epidaus as a new subgenus. This new subgenus differs from others by the presence of a hyaline area on the forewing distad of the postdiscal discal dark band; more produced, rounder forewing apex similar in shape to that of Mimoides; harpe with hookshaped process in the middle directed anteroventrad, also present in Boreographium but absent in others, e. g., in Mimoides, and differs from Boreographium by a broader dorsal keel and excavate distal margin. In DNA, a combination of the following characters is diagnostic in the nuclear genome: pgl 8036.1.5: T 51 A, pgl 231.44.1: G 809 A, pgl 231.44.1: T 816 C, pgl 2266.11.4: T 147 C, pgl 3034.5.5: T 39 A and in COI barcode: T 133 A, A 352 C, T 364 A, T 454 A, A 541 T. Etymology. In Greek, hyalos (ὕαλος) means glass; named for the glassy (i. e., hyaline) areas on forewings of the type species. The name is a masculine noun in the nominative singular. Species included. Only the type species (i. e., Papilio epidaus E. Doubleday, 1846). Parent taxon. Genus Eurytides Hübner, [1821].	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFEAFF88E22FAE76732D31EB.taxon	discussion	Comment. As a result, we partitioned the genus Eurytides into six subgenera: Mimoides, Hyalaus subgen. n., Boreographium, Neographium Möhn, 2002 (type species Papilio philolaus Boisduval, 1836), Eurytides, and Protesilaus W. Swainson, 1832 (Fig. 1).	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFE9FF85E1A2AB41741B3660.taxon	description	(Figs. 4 part, 5)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFE9FF85E1A2AB41741B3660.taxon	diagnosis	Definition and diagnosis. Genomic analysis of Microtia elva H. Bates, 1864 (type locality in Guatemala and Nicaragua) reveals that while more boldly patterned southern populations included in the subspecies Microtia elva horni Rebel, 1906 (type locality in Mexico: Oaxaca) (Fig. 4 labeled in cyan) are not phylogenetically separated from the nominotypical subspecies (Fig. 4 labeled in blue), the two specimens from Bogota in Colombia, which corresponds to the southernmost known record of the species, are genetically differentiated from the rest (Fig. 4 magenta) and we consider them to represent a new subspecies of M. elva. This new subspecies differs from its relatives by dark legs, brighter orange color of bands and spots, wider forewing band, and larger and rounder inner forewing margin spot than in the nominate subspecies, but narrower discal band on the hindwing, especially beneath. A combination of the following DNA characters is diagnostic in the nuclear genome: hm 2012473 - RA. 1: G 201 A, hm 2012473 - RA. 1: C 210 T, hm 2011393 - RA. 1: T 1506 A, hm 2011393 - RA. 1: A 1725 G, hm 2015159 - RA. 5: C 1024 A and in COI barcode: T 13 T, G 38 G, A 43 A, T 589 C, T 513 T. Barcode sequence of the holotype. Sample NVG- 22117 B 06, GenBank PP 254243, 658 base pairs: TACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAACATCTTTAAGACTTTTAATTCGAACTGAATTAGGAAACCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTTACAGCCCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTTCCATTAATATTAGGAGCTCCTGATATAGCTTTCCCTCGAA TAAATAATATAAGATTTTGATTACTACCTCCATCACTTATATTATTAATTTCTAGTAGTATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTACCCCCCACTTTCCTCCAATATTGC TCATAGCGGATCATCTGTTGATTTAGCAATTTTTTCTTTACATTTAGCAGGAATCTCTTCAATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGTATTAATAATATATCA TTTGATCAAATACCTTTATTTGTTTGAGCAGTAGGTATCACAGCTCTTTTATTATTATTATCATTACCAGTATTAGCAGGAGCTATTACCATACTTTTAACTGACCGAAATATTAATACAT CATTTTTTGACCCAGCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTT	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFE9FF85E1A2AB41741B3660.taxon	materials_examined	Type material. Holotype: ♂ deposited in the collection of Museum für Naturkunde, Berlin, Germany [MFNB], illustrated in Fig. 5, bears four labels, 1 st handwritten, others printed: three white [13 | VII], [Bogota | Nolcken], [DNA sample ID: | NVG- 22117 B 06 | c / o Nick V. Grishin], and one red [HOLOTYPE ♂ | Microtia elva | bogotana Grishin]. Paratype: 1 ♀ the same locality, collector, and repository as the holotype (NVG- 22117 B 07, bears an additional erroneous handwritten label “ Brasilien ”). Type locality. Colombia: Bogota.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFE9FF85E1A2AB41741B3660.taxon	etymology	Etymology. The name refers to the type locality.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFE9FF85E1A2AB41741B3660.taxon	distribution	Distribution. Colombia.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFE9FF85E1A2AB41741B3660.taxon	discussion	Comments. The lack of separation of subspecies into clades in the genomic trees (e. g., M. elva horni vs. M. elva horni) does not mean that the subspecies are not valid, it only means that this phylogenetic method does not separate them. Such a situation can arise due to limited genetic differentiation and / or extensive gene flow. Population analysis is needed to define groups of populations that are best treated as subspecies if phylogenetic tree methods fail. Finally, further research and additional specimens are needed to investigate whether M. elva bogotana ssp. n. might be a species-level taxon.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFE6FF87E1A6A9C874E735CC.taxon	diagnosis	Definition and diagnosis. Genomic analysis that includes the holotype of Boloria astarte tschukotkensis (Wyatt, 1961) (type locality in Russia: Chukotka Mts., sequenced as NVG- 20095 A 04) reveals that Boloria astarte (E. Doubleday, [1847]) (type locality in Canada: Alberta) partitions into four, not three, distinct clades. Three clades correspond to subspecies of B. astarte: the nominate (Fig 6 green), Boloria astarte distincta (A. Gibson, 1920) (type locality in Canada: Yukon, Harrington Creek) (Fig 6 blue), and B. astarte tschukotkensis (Fig 6 purple). The fourth clade (Fig 6 red) comprises populations from Alaska, USA, that are currently called B. astarte tschukotkensis but, as our analysis shows, are genetically distinct from it. While forming a prominent clade in the nuclear genome tree (Fig. 6 a), these populations from Alaska exhibit only 0.3 % (2 bp) difference in the COI barcode from the nominate B. astarte. Therefore, this Alaskan clade represents a new subspecies. This new subspecies differs from others by its generally smaller size, less extensive white overscaling beneath, e. g., near the outer margin of the ventral hindwing, the submarginal row of spots is not covered with white, and white scaling is mostly restricted to the belt between the marginal and submarginal row of spots. The submarginal spots are rounder on the ventral side, not triangular as in B. astarte distincta (Fig. 6 a vs. b). A notable difference is that the submarginal spots on the ventral forewing point outside (towards the margin) with their sharper ends in the new subspecies but inside (towards the wing base) in B. astarte distincta. The new subspecies differs from B. astarte tschukotkensis by better defined submarginal spots and weaker expressed and narrower dark framing in the discal area of ventral hindwing. A combination of the following DNA characters in the nuclear genome is diagnostic: hm 2009446 - RA. 6: T 96 A, hm 2010326 - RA. 1: G 46 A, hm 2002793 - RA. 5: C 72 T, hm 2010724 - RA. 2: T 198 A, hm 2010724 - RA. 2: C 255 A but COI barcodes do not identify it consistently. Barcode sequence of the holotype. Sample NVG- 21068 B 11, GenBank PP 254244, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACATCTCTTAGTTTACTAATTCGAACTGAATTAGGTAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGTAATTGATTAGTACCTTTAATATTAGGAGCCCCAGATATAGCATTTCCCCGTA TAAATAATATAAGATTTTGACTTTTACCCCCATCTTTAATTTTACTTATTTCAAGTAGAATTGTCGAAAATGGAGCAGGAACAGGATGAACAGTGTACCCCCCACTTTCATCTAATATTGC TCATAGAGGAGCTTCAGTAGACCTAGCAATTTTTTCTCTACATTTAGCTGGTATTTCCTCCATCCTAGGAGCTATTAATTTTATTACCACAATTATTAATATACGGATTAATAATATATCT TTTGATCAAATACCATTATTTGTATGAGCTGTAGGTATTACAGCTTTATTACTTTTATTATCTTTACCAGTTTTAGCAGGAGCTATTACAATACTTTTAACTGATCGTAATTTAAATACTT CATTTTTTGATCCTGCAGGAGGAGGAGATCCCATTTTATATCAACATTTATTT	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFE6FF87E1A6A9C874E735CC.taxon	materials_examined	Type material. Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity, Florida Museum of Natural History, Gainesville, FL, USA [MGCL], illustrated in Fig. 7, bears four labels, 1 st handwritten, others printed: three white [Omilak, Darby Mtns | Alaska | June 24, 1986 | Collectors | J + L Troubridge], [J. & F. Preston Coll. | Allyn Museum | Acc. 1989 - 21], [DNA sample ID: | NVG- 21068 B 11 | c / o Nick V. Grishin], and one red [HOLOTYPE ♂ | Boloria astarte | alaskia Grishin]. Paratypes: 2 ♂♂ and 2 ♀♀: from USA: Alaska: 1 ♂ Seward Peninsula, Kougarok Road, mile 48, Big Creek, elevation 1100 ft, 16 - Jul- 1979, Joseph D. Zeligs leg. (NVG- 22039 A 05, fig. James Scott book, from James A. Scott collection); 1 ♀ Brooks Range, Chandalar Shelf Ridge, W of Dalton Hwy mile 237.5, 24 - 25 - Jun- 1999, Malcolm G. Douglas leg. (NVG- 21068 C 01) [MGCL]; North Slope Borough, Dalton Highway, W. R. Dempwolf leg.: 1 ♂ N of Atigun Pass, elevation 2784 ', GPS 68.1558, − 149.4361, 12 - Jul- 2021 (NVG- 22059 C 05, WRD 20230) and 1 ♀ near Atigun Pass, elevation 3700 ', GPS 68.1397, − 149.4439, 11 - Jul- 2021 (NVG- 22059 C 06, WRD 20229).	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFE6FF87E1A6A9C874E735CC.taxon	etymology	Etymology. The name refers to the state of the type locality.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFE6FF87E1A6A9C874E735CC.taxon	distribution	Distribution. From the Seward Peninsula to the Brooks Range in Alaska, USA.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFE5FF86E190ABF27243339D.taxon	description	(Figs. 9 part, 10 a)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFE5FF86E190ABF27243339D.taxon	diagnosis	Definition and diagnosis. Genome-based phylogeny of Ithomiola (Ithomiola) C. Felder & R. Felder, 1865 (type species Ithomiola floralis C. Felder & R. Felder, 1865) reveals that specimens from Panama (Fig. 9 red) identified as Ithomiola tessera J. Hall, 2005, stat. nov. (type locality in Mexico: Veracruz) (Fig. 9 blue) due to their large and blotchy white discal spots on the forewing are genetically differentiated from it at the species level (Fig. 9), e. g., their COI barcodes differ by 3.0 % (20 bp), and therefore represent a new species. This species differs from its relatives by large and aligned discal white macules on the forewing that touch each other, as in I. tessera, from which its females can be differentiated by typically larger discal macules on both wings (but usually smaller postdiscal spots) and hindwing discal macule stronger separated from costa by brown: small white spot in cell Sc + R 1 - Rs instead of a larger spot in typical I. tessera; and putative males (none sequenced) differ by more extensive blue scaling in the tornal area of dorsal hindwing. Because phenotypic variation of this species has not been explored and due to the absence of confirmed males, definitive identification is provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome: cne 2399.14.5: A 156 G, cne 6395.2.1: T 631 C, cne 1958.7.3: T 204 C, cne 1958.7.3: C 477 T, cne 1661.11.5: T 813 C and in COI barcode: A 277 C, C 343 T, T 382 A, T 595 C, T 634 C. Barcode sequence of the holotype: Sample NVG- 23013 H 06, GenBank PP 254245, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGTACATCTTTAAGTTTATTAATTCGTATAGAATTAGGTATACCTGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGTTTTGGAAATTGACTTGTTCCTTTAATATTAGGAGCTCCAGATATAGCTTTTCCTCGTA TAAATAATATAAGATTTTGACTTCTTCCTCCTTCCTTATTTCTTCTTATTTCAAGAAGAATTGTTGAAAATGGTGCAGGTACTGGATGAACTGTTTACCCTCCTTTATCTTCTAACATTGC TCATGGAGGATCTTCTGTAGATTTAGCAATTTTCTCATTACATTTAGCAGGTATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACTATTATTAATATACGTATTAATAATTTATCA TTTGATCAAATACCTTTATTTGTATGATCTGTAGGAATTACAGCATTATTATTACTTTTATCTTTACCTGTATTAGCAGGTGCAATTACTATATTATTAACAGACCGAAACTTAAATACTT CATTTTTTGACCCTGCTGGAGGAGGTGACCCTATTCTTTATCAACATTTATTT	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFE5FF86E190ABF27243339D.taxon	materials_examined	Type material. Holotype: ♀ deposited in the Zoologische Staatssammlung München, Germany [ZSMC], illustrated in Fig. 10 a, bears three printed labels: two white [Chiriqui], [DNA sample ID: | NVG- 23013 H 06 | c / o Nick V. Grishin] and one red [HOLOTYPE ♀ | Ithomiola (Ithomiola) | tesseroides Grishin]. Paratype: 1 ♀ with two original labels [920], [Theages | Godm. & Salv. | Amaz.], likely mislabeled from Panama and might also be from Chiriqui (NVG- 23013 H 12, GenBank barcode PP 254246) [ZSMC]. Type locality. Panama: Chiriqui.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFE5FF86E190ABF27243339D.taxon	etymology	Etymology. Formed from the name of I. tessera, which is a more northern species with similarly large and squarish adjoining discal forewing spots. In Latin, tessera means a square piece of stone, and it was given to that species for the forewing spots. The name is an adjective.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFE5FF86E190ABF27243339D.taxon	distribution	Distribution. Panama (at least).	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFE5FF80E18CACA172F937F1.taxon	diagnosis	Definition and diagnosis. Genome-based phylogeny of Ithomiola (Ithomiola) C. Felder & R. Felder, 1865 (type species Ithomiola floralis C. Felder & R. Felder, 1865) reveals that a specimen from Panama (Fig. 9 magenta) identified as Ithomiola cribralis (Stichel, 1915) (type locality in Ecuador) (Fig. 9 green) due to phenotypic similarities, is genetically differentiated from it at the species level (Fig. 9), e. g., their COI barcodes differ by 2.3 % (15 bp), and therefore represents a new species. This species is most similar to its closest relative, I. cribralis, and differs from it by larger forewing white spots in both sexes (compare within each sex), larger hindwing discal white patch, and blue scaling extending farther from the tornus along the hindwing outer margin. For additional illustrations, see Figs. 62 A (holotype), 62 B (paratype), and 146 (male genitalia of the holotype) in Hall (2005), who has not illustrated true I. cribralis showing this species instead. Because the phenotypic variation of this species has not been extensively explored, definitive identification is provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome: cne 10210.1.1: A 505 C, cne 10210.1.1: A 507 G, cne 804.5.4: A 99 G, cne 41. 6.2: T 747 C, cne 41.6.2: A 777 G, cne 9763.1.7: C 72 C (not T), cne 5785.2.3: C 93 C (not T), cne 191.3.2: T 87 T (not C), cne 10809.1.1: T 36 T (not C), cne 6006.2.2: T 132 T (not A) and in COI barcode: T 40 A, T 184 C, T 376 C, A 403 G, T 500 C, T 653 C.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFE5FF80E18CACA172F937F1.taxon	description	AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACATCTTTAAGATTATTAATTCGTATAGAATTAGGTATACCTGGATCTTTAATTGGTGATGATCAAATTTATAACACT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGCTTTGGAAATTGACTTGTTCCTTTAATGTTAGGAGCTCCAGATATAGCTTTTCCTCGTA TAAATAACATAAGATTTTGACTTTTACCTCCTTCATTAATTCTGCTTATTTCAAGAAGAATTGTTGAAAATGGTGCAGGTACTGGATGAACTGTTTACCCCCCTTTATCTTCTAATATTGC ACATGGAGGATCCTCTGTTGACTTAGCAATTTTTTCATTGCATTTAGCAGGTATTTCATCTATTTTAGGAGCTATTAATTTTATTACAACTATTATTAATATACGTATTAATAATTTATCA TTTGATCAAATACCTCTATTTGTTTGATCTGTAGGAATTACAGCATTACTATTACTTTTATCTTTACCTGTATTAGCAGGTGCTATTACTATATTATTAACAGATCGAAATTTAAATACTT CATTTTTTGATCCTGCTGGAGGAGGTGATCCTATTCTTTATCAACATCTATTT	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFE5FF80E18CACA172F937F1.taxon	materials_examined	Type material. Holotype: ♂ deposited in the National Museum of Natural History, Washington, DC, USA [USNM], illustrated in Fig. 10 b, bears five printed (text in italics handwritten) labels: four white [PANAMA: PANAMA | Cerro Jefe 900 m. | IV- 22. 19 77 | G. B. Small], [Genitalia Dissection | # 1999 - 62 | Donald J. Harvey], [DNA sample ID: | NVG- 18122 D 02 | c / o Nick V. Grishin], [USNMENT | {QR Code} | 01532041], and one red [HOLOTYPE ♂ | Ithomiola (Ithomiola) | coladoris Grishin]. Paratype: 1 ♀ the same data as the holotype, illustrated by Hall (2005) as Fig. 62 B (not sequenced). Type locality. Panama: Panama, Cerro Jefe, elevation 900 m.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFE5FF80E18CACA172F937F1.taxon	etymology	Etymology. In Latin, cribrum means sieve or strainer and is a possible root of the name cribralis, given by Stichel to the sister of the new species, likely for the pattern of small white spots resembling small holes of a sieve. The new species has bigger spots, more similar to holes in colander, or colador in Spanish, hence the name, which is an adjective.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFE5FF80E18CACA172F937F1.taxon	distribution	Distribution. Known only from Panama.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFE3FF83E196A943747235C4.taxon	diagnosis	Definition and diagnosis. Genome-based phylogeny of Ithomiola (Ithomiola) C. Felder & R. Felder, 1865 (type species Ithomiola floralis C. Felder & R. Felder, 1865) reveals that a specimen from Cuzco, Peru (Fig. 9 orange) identified as Ithomiola bajotanos J. Hall, 2005 (type locality in Ecuador: Tungurahua) (Fig. 9 green) due to phenotypic similarities is genetically differentiated from it at the species level (Fig. 9), e. g., its COI barcode differs by 2.1 % (14 bp) from I. bajotanos paratype from Colombia, and therefore represents a new species. This species is most similar to its closest relative, I. bajotanos, in size and less developed blue spots in the basal area of the dorsal forewing, and differs from it by smaller white spots in the ventral hindwing discal area in cells Sc + R 1 - Rs and Rs-M 1. These spots are larger than in a typical Ithomiola tanos (Stichel, 1910) (type locality in Bolivia, holotype sequenced as NVG- 18078 C 09). Furthermore, forewing spots are, on average, smaller, and darker brown areas basad of spots on the ventral side are longer. Because phenotypic variation of this species has not been explored, definitive identification is provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome: cne 7381.3.1: A 60 G, cne 5239.2.2: T 39 C, cne 5239.2.2: A 129 C, cne 10306.1.1: C 858 T, cne 7597.1.2: T 96 C, cne 3123.5.1: T 249 T (not C), cne 8031.2.1: C 384 C (not A), cne 8031.2.1: T 390 T (not A), cne 224.6.2: T 48 T (not A), cne 123.8.6: C 521 C (not T) and in COI barcode: A 46 T, T 124 C, T 205 C, T 265 C, A 474 G, T 499 C, 508 G. Barcode sequence of the holotype: Sample NVG- 19038 C 05, GenBank PP 254248, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAATCGGAACTTCTTTAAGTTTATTAATTCGAATAGAATTAGGTACTCCAGGATCTTTAATTGGTGATGATCAAATTTATAACACT ATCGTTACAGCTCATGCTTTTATTATAATTTTCTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGACTTGTTCCCTTAATATTAGGAGCTCCAGATATAGCTTTCCCTCGTA TAAATAATATAAGATTTTGACTCCTTCCCCCTTCATTATTTCTTCTTATTTCAAGAAGAATTGTTGAAAATGGAGCAGGTACTGGATGAACTGTATATCCTCCTTTATCTTCTAATATTGC CCATGGAGGATCTTCTGTTGATTTAGCAATTTTCTCTTTACATTTAGCAGGTATTTCATCAATTTTAGGAGCTATTAATTTTATTACTACTATTATTAATATACGTATTAGTAATTTATCA TTTGATCAAATACCCTTATTTGTGTGATCAGTTGGTATTACAGCATTATTATTACTTTTATCTCTTCCTGTATTAGCAGGAGCTATTACTATATTATTAACAGATCGAAATTTAAATACTT CATTTTTTGATCCTGCTGGAGGAGGAGATCCTATTCTTTATCAACACTTATTT	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFE3FF83E196A943747235C4.taxon	materials_examined	Type material. Holotype: ♂ currently deposited in the National Museum of Natural History, Washington, DC, USA [USNM], illustrated in Fig. 10 c, bears four printed labels: three white [PERU: Cuzco 1194 m. | Quebrada Santa Isabel | Cosnipata Valley 4738 | 27 - III- 2016 Kinyon], [DNA sample ID: | NVG- 19038 C 05 | c / o Nick V. Grishin], [USNMENT | {QR Code} | 01544965], and one red [HOLOTYPE ♂ | Ithomiola (Ithomiola) | perutanos Grishin]. Type locality. Peru: Cuzco, Cosñipata Valley, Quebrada Santa Isabel, elevation 1194 m, approximate GPS − 13.017, − 71.500. name), perutanos means tanos from Peru. The name is a noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFE3FF83E196A943747235C4.taxon	distribution	Distribution. Known only from the holotype collected in Cuzco, Peru.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFE0FF9DE205AE8973B136CF.taxon	description	(Figs. 11 part, 12)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFE0FF9DE205AE8973B136CF.taxon	diagnosis	Definition and diagnosis. Genomic analysis of Lasaia H. Bates, 1868 (type species Papilio meris Stoll, 1781) reveals a clade of three specimens from Colombia and Venezuela (Fig. 11 red) sister to both L. peninsularis Clench, 1972 (type locality in Mexico: Yucatan) and L. sula Staudinger, 1888 (type locality in Honduras) in the nuclear genome tree (Fig. 11 cyan and purple). This clade consists of paler in appearance specimens not associated with any available name. In the COI barcodes, specimens from this clade differ by 4.7 % (31 bp) from L. pseudomeris Clench, 1972 (type locality in Bolivia) and by 5.6 % (37 bp) from L. sula. Therefore, this clade represents a new species. This new species differs from its relatives by a combination of the following characters: generally paler and greener, with less developed black spotting above mostly constrained to the forewing apex and anterior portion, paler areas towards costa on the dorsal side of both wings, two prominent subapical pale spots, hindwing with brown spots weakly developed, restricted to the area near the costa and in some specimens the base; ventrally darker than many other species, hindwing with paler basal third, most prominent nearly white area anterior of discal cell, but towards the outer margin it is only somewhat paler than the discal area, without contrasting pale patches in the submarginal area. The entire type series is illustrated (Fig. 12) because the three specimens differ in their appearance, giving a range of phenotypic variation in this species. Definitive identification is provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome: and in COI barcode: T 103 C, A 295 T, T 478 C, T 586 G, A 643 G. Barcode sequence of the holotype. Sample NVG- 23014 A 03, GenBank PP 254249, 658 base pairs: AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGTACATCTTTAAGTTTATTAATTCGTATAGAATTAGGTATGCCAGGATCATTAATTGGTGACGATCAAATTTATAATACT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTCATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTACCTTTAATATTAGGAGCTCCTGATATAGCATTTCCACGAA TAAATAATATAAGATTTTGACTTTTACCTCCATCTTTATTTCTACTAATTTCTAGAAGTATTGTAGAAAACGGAGCAGGAACTGGATGAACAGTTTACCCCCCACTGTCTTCTAATATTGC TCATGGAGGATCTTCTGTAGATTTAGCTATTTTTTCTCTTCATTTAGCTGGAATTTCTTCAATTTTAGGAGCTATTAATTTTATTACAACTATTATTAATATACGAATTAATAACTTATCC TTTGATCAAATACCACTTTTTGTCTGATCAGTTGGTATTACTGCTTTATTATTATTATTATCATTACCTGTTTTAGCAGGAGCTATTACTATATTATTAACGGATCGTAATTTAAATACAT CTTTTTTTGATCCTGCAGGAGGAGGTGATCCAATTCTGTATCAACATTTATTC	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFE0FF9DE205AE8973B136CF.taxon	materials_examined	Type material. Holotype: ♂ deposited in the Zoologische Staatssammlung München, Germany [ZSMC], illustrated in Fig. 12 a, bears four labels, 2 nd handwritten, others printed: three white [Venezuela | Maracay | ges. P. Vogl], [Lasaia | meris | Stoll], [DNA sample ID: | NVG- 23014 A 03 | c / o Nick V. Grishin], and one red [HOLOTYPE ♂ | Lasaia pallida | Grishin]. Paratypes: 2 ♂♂: the same data as the holotype, 1936 (NVG- 23014 A 04) and Colombia, Karsten leg. (NVG- 22112 G 05) [MFNB]. Type locality. Venezuela: Maracay.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFE0FF9DE205AE8973B136CF.taxon	etymology	Etymology. In Latin, pallidus means pale or pallid. The name refers to the paler appearance of this species, particularly towards the costa on both wings above and the basal third of the hindwing beneath, and is a feminine adjective.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFE0FF9DE205AE8973B136CF.taxon	distribution	Distribution. Colombia and Venezuela.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFE0FF9DE205AE8973B136CF.taxon	discussion	Comments. Although we have not yet sequenced Lasaia meris (Stoll, 1781) (type locality in Suriname) and Lasaia maritima J. Hall & Lamas, 2001 (type locality in Peru: Piura), Lasaia pallida sp. n. is a species distinct from them. From the original illustration, L. meris is a strongly patterned species with well-developed pale submarginal areas on the hindwing (Stoll 1780 – 1782), and thus differs from leastpatterned Lasaia pallida sp. n. Querying BOLD database (Ratnasingham and Hebert 2007) with COI barcodes of our sequenced specimens reveals that L. maritima is a species closely related to Lasaia agesilas (Latreille, [1809]) (type locality in Peru), similarly to Lasaia aerugo Clench, 1972 (type locality in Peru: Cajamarca), and thus different from Lasaia pallida sp. n.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFFEFF9CE1BEAE7E729E309F.taxon	description	(Figs. 13 part, 14)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFFEFF9CE1BEAE7E729E309F.taxon	diagnosis	Definition and diagnosis. Genomic analysis of Lasaia H. Bates, 1868 (type species Papilio meris Stoll, 1781) reveals that a specimen from Oaxaca, Mexico (Fig. 13 magenta, 14) is genetically differentiated from Lasaia sessilis Schaus, 1890 (type locality in Mexico: Veracruz, Coatepec, syntype sequenced as NVG- 18048 A 05) (Fig. 13 blue), but not very prominently, e. g., their COI barcodes differ by 1.4 % (9 bp). Therefore, this specimen represents a new taxon that we regard as a subspecies. This new subspecies is most similar to L. sessilis but differs from it by forewing dark dashes that are narrower, more connected with each other (rather than forming separate spots), and weaker developed than in L. sessilis, but hindwing dashes are better expressed on the dorsal side, especially towards the inner margin where they typically fade in L. sessilis, and costal area of dorsal hindwing paler than in a typical L. sessilis. Due to unexplored phenotypic variation, definitive identification is provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome: cne 3288.5.1: C 402 G, cne 205.20.3: T 84 C, cne 640. 6.18: A 55 G, cne 640.6.18: T 75 C, cne 7.2.1: T 15 A, cne 7425.7.4: A 24 A (not G), cne 1806.4.1: T 119 T (not C), cne 790.10.6: C 57 C (not G), cne 10214.8.11: G 63 G (not A), cne 49345.1.3: T 60 T (not C) and in COI barcode: T 49 A, A 241 A, A 295 A, T 403 C, T 616 C. Barcode sequence of the holotype. Sample NVG- 19069 B 11, GenBank PP 254250, 658 base pairs: AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGTACATCATTAAGTTTATTAATTCGTATAGAATTAGGTATACCAGGATCATTAATTGGTGATGATCAAATTTATAATACT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATCATAATTGGAGGTTTTGGAAATTGATTAGTACCATTAATATTAGGAGCACCTGATATAGCATTTCCACGAA TAAATAATATAAGATTCTGACTTCTTCCCCCATCTTTATTTCTTTTAATTTCAAGAAGTATTGTAGAAAATGGAGCAGGAACTGGATGAACAGTTTACCCCCCACTGTCTTCTAATATTGC TCATAGAGGATCCTCAGTAGATTTAGCTATTTTTTCTCTCCATTTAGCTGGAATTTCATCTATTTTAGGAGCTATTAATTTTATTACAACTATTATTAATATACGTATTAATAATTTATCT TTTGATCAAATACCATTATTTATCTGATCAGTTGGTATTACTGCTTTATTATTATTATTATCTTTACCAGTTTTAGCAGGAGCTATTACAATATTATTAACAGACCGTAATTTAAATACAT CTTTTTTTGACCCAGCAGGAGGTGGAGATCCAATTTTATATCAACATTTATTT	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFFEFF9CE1BEAE7E729E309F.taxon	materials_examined	Type material. Holotype: ♂ deposited in the University of Texas Biodiversity Center insect collection, Austin, TX, USA [TMMC], illustrated in Fig. 14, bears five labels: 3 rd handwritten, others printed; 2 nd and 5 th red, others white: [Mexico: Oaxaca, | La Soledad – Buena Vista | ~ 5000 ' 5 - 6. v. 1990 | J. Kemner leg. # 200], [Texas Memorial | Museum – UTexas | JKemner Spec. | 1197], [200], [DNA sample ID: | NVG- 19069 B 11 | c / o Nick V. Grishin], and [HOLOTYPE ♂ | Lasaia sessilis | oaxacensis Grishin]. The numbers 1197 and 200 refer to the specimen and the locality, respectively, in the Kemner files in TMMC collection. The first label was made for the holotype using data in these files and added to the specimen together with the last (holotype) label. Only the 2 nd and 3 rd labels were original labels on this specimen. Type locality. Mexico: Oaxaca, Sierra Madre del Sur, La Soledad – Buena Vista, elevation ca. 5000 ’.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFFEFF9CE1BEAE7E729E309F.taxon	etymology	Etymology. The name refers to the type locality and is a feminine adjective.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFFEFF9CE1BEAE7E729E309F.taxon	distribution	Distribution. Currently known only from the holotype collected in Oaxaca, Mexico.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFFEFF9CE1BEAE7E729E309F.taxon	discussion	Comment. Further research and additional specimens are needed to investigate whether L. sessilis oaxacensis ssp. n. could be a species-level taxon.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFFFFF9FE1BAAFAF756C3046.taxon	description	Zimsen (1964) did not specify repositories of S. regulus syntypes, which were from the Drury collection. We are not aware of their whereabouts and are researching this question. Presently, short of a neotype designation if no syntypes can be located, our identification of this species is based on the Jones’ illustration (Oxford University Museum of Natural History 2021), which shows a comparatively large female with broad pale-yellow markings and a ventral hindwing brown border without a pair of yellow marginal spots inside it. According to our analysis, only one species of the S. regulus complex lacks these yellow spots. It is a Southeast Brazilian species, where it may be sympatric with S. attilius. We identify the “ holotype ” of an infrasubspecific name Nymula regulus regulus forma ingens Stichel, 1925 (from Brazil: Espirito Santo, sequenced as NVG- 21119 F 08) referring to a “ giant form ” of the species (Stichel 1925) as S. regulus, in agreement with Stichel. However, not all S. regulus specimens are that large, and NVG- 21119 F 08 is smaller than an average S. attilius. Besides the absence of yellow marginal spots inside the brown ventral hindwing marginal area, males of S. regulus can be distinguished from S. attilius by a more concave outer edge and more convex inner edge of the postbasal yellow band near the inner margin of the dorsal hindwing (i. e., more crescent-shaped postbasal dorsal hindwing band). In addition to S. regulus and S. attilius being distinct species, the genomic analysis revealed five more species in the S. regulus complex (Fig. 15). All five are new and they are described below.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFFCFF9EE216AFF274ED3375.taxon	diagnosis	Definition and diagnosis. A sole specimen from the S. regulus group that we sequenced from Chanchamayo, Peru (Fig. 15 magenta) is genetically differentiated from its sister clade composed of specimens from Brazil: Pará (which belong to another new species described below) (Fig. 15 green) at the species level: e. g., their COI barcodes differ by 2.3 % (15 bp). Therefore, this female with a unique phenotype (Fig. 16 a) represents a new species. This new species differs from its relatives by extensive and broad yellow areas on wings (even broader than in S. regulus), including broader submarginal macules on the forewing that are nearly touching each other, narrower broad bands, smaller marginal yellow spots on ventral side near each wing’s tornus (absent in S. regulus) and lacking yellow marginal spot in cell M 3 - CuA 1 (absent in S. regulus but present in species with broad yellow bands). Due to unexplored phenotypic variation, definitive identification is provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome: cne 30383.1.1: C 324 T, cne 30383.1.1: A 327 C, cne 2564.25.13: G 51 A, cne 3039.2.4: C 36 T, cne 3039.2.4: A 141 T, cne 2462.3.2: C 153 C (not T), cne 8137.3.1: G 420 G (not T), cne 5683.4.1: T 929 T (not A), cne 17882.2.1: A 79 A (not G), cne 1029.3.3: C 114 C (not T) and in COI barcode: T 85 C, G 337 G, T 400 C, A 562 G, A 619 C. Barcode sequence of the holotype. Sample NVG- 22117 D 06, GenBank PP 254251, 658 base pairs: AACTTTATATTTTATTTTTGGAATCTGAGCAGGTATAATAGGAACATCTCTTAGTTTATTAATTCGAATAGAATTAGGAATTCCCGGTTCTTTAATTGGAAATGATCAAATTTATAATACT ATTGTTACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCATTAATATTAGGAGCTCCAGATATAGCTTTCCCTCGTA TAAATAATATAAGATTTTGATTATTACCCCCATCTTTATTTTTATTAATTTCTAGAAGAATTATTGAAAATGGAGCAGGAACTGGATGAACTGTGTACCCCCCACTTTCATCTAATATTGC TCATAGAGGAGCTTCTGTTGATTTAGCTATTTTTTCCCTTCATTTAGCTGGAATTTCATCAATTTTAGGTGCAATTAATTTTATTACAACTATTATTAATATACGTATTAATAATTTATCA TTTGATCAAATACCTTTATTTATTTGATCTGTAGGAATTACTGCTCTTCTTCTTTTATTATCTTTACCTGTTTTAGCGGGAGCTATTACTATACTACTTACAGATCGAAATTTAAATACAT CTTTTTTTGATCCCGCAGGAGGTGGAGATCCAATTTTATATCAACATTTATTT	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFFCFF9EE216AFF274ED3375.taxon	materials_examined	Type material. Holotype: ♀ currently deposited in the collection of Museum für Naturkunde, Berlin, Germany [MFNB], illustrated in Fig. 16 a, bears five labels: 2 nd handwritten and others printed; 1 st green, 5 th red, and others white [Chanchamayo | G. Tessmann], [spec. | (cf. zonata) | ♀ | 583] (the number is rotated 90 ° counterclockwise relative to the rest of the text and written along the right side of the label), [ex coll. | H. STICHEL], [DNA sample ID: | NVG- 22117 D 06 | c / o Nick V. Grishin], and [HOLOTYPE ♀ | Synargis | regina Grishin]. Type locality. Peru: Chanchamayo.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFFCFF9EE216AFF274ED3375.taxon	etymology	Etymology. In Latin, regulus means little king or prince. It is a diminutive form of rex, which means king. In Latin, regina means queen, and this name is given to this brightest species of the group. The name is a noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFFCFF9EE216AFF274ED3375.taxon	distribution	Distribution. Currently known only from the holotype collected in central Peru.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFFDFF99E1E5ACC572EF3114.taxon	diagnosis	Definition and diagnosis. Several specimens from the S. regulus group collected in Brazil: Pará (Fig. 15 green) are genetically distinct from all others at the species level, e. g., COI barcode difference from their sister S. regina sp. n. (Fig. 15 magenta) is 2.3 % (15 bp). Therefore, they represent a new species. This new species differs from its relatives by broader yellow bands and submarginal yellow macules, which are ventral side (including a comparatively large yellow spot in cell M 3 - CuA 1) fully penetrating the brown border and connected with the postdiscal yellow area, and dorsally brown abdomen in males. Due to unexplored phenotypic variation, definitive identification is provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome: cne 294.1.1: G 44 T, cne 294.1.1: C 59 G, cne 2806.2.1: T 90 C, cne 935.2.3: G 351 A, cne 935.2.3: C 354 T and in COI barcode: A 94 G, C 235 T, T 283 C, T 454 C, T 646 C. Barcode sequence of the holotype. Sample NVG- 22117 E 03, GenBank PP 254252, 658 base pairs: AACTTTATATTTTATTTTTGGAATCTGAGCAGGTATAATAGGAACATCTCTTAGTTTATTAATTCGAATAGAATTAGGAATTCCTGGTTCTTTGATTGGAAATGATCAAATTTATAATACT ATTGTTACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAATTCCATTAATATTAGGAGCTCCAGATATAGCTTTTCCTCGTA TAAATAATATAAGATTTTGATTATTACCTCCATCTTTATTCTTATTAATTTCTAGAAGAATTATTGAAAATGGAGCAGGAACTGGATGAACTGTATATCCCCCACTTTCATCTAATATTGC TCATGGAGGAGCTTCTGTTGATTTAGCTATTTTTTCTCTTCATTTAGCTGGAATTTCATCAATTTTAGGTGCAATTAATTTTATTACAACCATTATTAATATACGTATTAATAATTTATCA TTTGATCAAATACCTTTATTTATTTGATCTGTAGGAATTACTGCTCTTCTTCTTTTATTATCTTTACCTATTTTAGCAGGAGCTATTACTATACTACTTACAGATCGAAATTTAAATACAT CTTTTTTTGACCCCGCAGGAGGTGGAGATCCAATTTTATACCAACATTTATTT	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFFDFF99E1E5ACC572EF3114.taxon	materials_examined	Type material. Holotype: ♀ currently deposited in the collection of Museum für Naturkunde, Berlin, Germany [MFNB], illustrated in Fig. 16 b, bears four printed labels: three white [Itait. | Mich.], [ex coll. | H. STICHEL], [DNA sample ID: | NVG- 22117 E 03 | c / o Nick V. Grishin], and one red [HOLOTYPE ♀ | Synargis | reginella Grishin]. According to the 1 st label, the holotype was collected in Itaituba (Pará, Brazil) by Michael, probably in 1890. This year is on a similarly styled label of the topotypical paratype. A female is chosen as the holotype for best comparison with female primary types of S. regina sp. n. and Jones’ drawing S. regulus. Paratypes: 2 ♂♂ and 2 ♀♀ from Brazil, Pará [MFNB]: 1 ♂ the same data as the holotype, 1890 (NVG- 22117 D 07) and from Santarem: 1 ♂ (NVG- 22117 E 01, Stichel collection number 1620), 1 ♀ (NVG- 22117 E 02, Stichel No 2088), and 1 ♀ (NVG- 22117 E 04, Stichel No 315). Type locality. Brazil: Pará, Itaituba.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFFDFF99E1E5ACC572EF3114.taxon	etymology	Etymology. In Latin, regulus means little king or prince. It is a diminutive form of rex, which means king. In Latin, reginella is a diminutive of regina, which means queen, and the name is given to this species that resembles regina but is not that bright. The name is a noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFFDFF99E1E5ACC572EF3114.taxon	distribution	Distribution. Lower Amazonian region.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFFAFF9BE1E9AE2272DC3499.taxon	diagnosis	Definition and diagnosis. Genomic analysis of the S. regulus group reveals a clade that, being distinct from all other species, itself consists of three species-level undescribed taxa (Fig. 15 red, purple, and orange). The first species (Fig. 15 red) with specimens sequenced from Peru differs in COI barcode from each of the other two species by 2.6 % (17 bp). This new species is differentiated from its relatives by narrower than in several others yellow bands and submarginal macules, strongly developed marginal yellow spots inside brown border on the ventral side of wings, including the spot in cell M 3 - CuA 1; this spot is connected or nearly connected with the subapical elongated macule. Many males have a dorsally yellow caudal half of the abdomen (yellow ventrally as in other species). Due to unexplored phenotypic variation, definitive identification is provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome: cne 664.10.2: C 508 A, cne 664.10.2: C 519 T, cne 2800.7.1: C 655 G, cne 2800.7.1: C 660 A, cne 9234.1.8: T 88 C and in COI barcode: T 103 C, C 340 T, T 407 C, A 451 C, T 578 C. Barcode sequence of the holotype. Sample NVG- 22117 E 05, GenBank PP 254253, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGTATAGTAGGAACATCTCTTAGTTTACTAATTCGAATAGAATTAGGAACTCCTGGATCTTTAATTGGAGACGATCAAATTTATAATACT ATTGTTACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAACTGATTAGTTCCATTAATATTAGGAGCTCCTGATATAGCTTTCCCCCGTA TAAATAATATAAGATTTTGATTATTACCTCCTTCTTTATTTTTATTAATCTCCAGAAGAATTGTTGAAAATGGAGCAGGAACTGGATGAACAGTATATCCCCCACTTTCATCTAATATTGC TCATAGAGGAACTTCTGTTGATTTAGCTATTTTTTCTCTTCATCTAGCTGGAATTTCATCAATCTTAGGTGCAATTAATTTTATTACCACTATTATTAATATACGTATTAATAATTTATCA TTTGATCAAATACCTTTATTTGTTTGATCAGTAGGAATTACTGCTCTTCTTCTTTTATTATCATTACCTGTTTTAGCGGGAGCTATTACTATACTACTTACTGATCGAAATTTAAACACAT CTTTTTTTGATCCTGCAGGAGGTGGAGATCCAATTTTATATCAACATTTATTT	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFFAFF9BE1E9AE2272DC3499.taxon	materials_examined	Type material. Holotype: ♂ currently deposited in the collection of Museum für Naturkunde, Berlin, Germany [MFNB], illustrated in Fig. 17 a, bears four labels: 2 nd handwritten and others printed; 1 st green, 4 th red, and others white [Mt. Alegre, Rio | Pachitea O. Peru | G. Tessmann], [regulus F. | f. sylvarum Bat.], [DNA sample ID: | NVG- 22117 E 05 | c / o Nick V. Grishin], and [HOLOTYPE ♂ | Synargis | 22117 D 04 and NVG- 22117 E 06) and 1 ♂ from Peru: Chanchamayo, G. Tessmann leg. (NVG- 22117 D 05). Type locality. Peru: Rio Pachitea, Monte Alegre. This is also the type locality of Pseudophaloe tessmanni Hering, 1925 (Erebidae: Arctiinae) and Hylesia natex Draudt, 1929 (Saturniidae).	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFFAFF9BE1E9AE2272DC3499.taxon	etymology	Etymology. In Latin, flavus means yellow or golden, and cauda means tail. The compound word flavicauda refers to the yellow distal half of the abdomen dorsal side in males of this species. This coloration may also be present in other species of the group but is typically less pronounced. The name is an adjective.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFFAFF9BE1E9AE2272DC3499.taxon	distribution	Distribution. Central and East-central Peru.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFF8FF9AE1FBABAB7490309B.taxon	diagnosis	Definition and diagnosis. Genomic analysis of the S. regulus group reveals a clade that, being distinct from all other species, itself consists of three species-level undescribed taxa (Fig. 15 red, purple, and orange). The second species (Fig. 15 purple) with specimens sequenced from Brazil: Bahia and with incomplete or missing data (likely from Southeast Brazil) differs in COI barcode by 2.6 % (17 bp) from S. flavicauda sp. n. and by 2.0 % (13 bp) from the new species described next. This new species is differentiated from its relatives by narrower than in nearly all other species yellow bands and submarginal macules, discal bands not much wider than submarginal bands and macules, weaker developed (but present) marginal yellow spots inside brown border on the ventral side of wings, including a small spot in the cell M 3 - CuA 1 that does not reach subapical elongated macule, more strongly defined than in other species dark brown area by tornus on the ventral hindwing, mostly dorsally brown abdomen, and larger size, similar to that of many specimens of S. regulus. Due to unexplored phenotypic variation, definitive identification is provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome: cne 4191.9.4: T 63 C, cne 1381.2.3: C 702 T, cne 3677.1.5: C 150 T, cne 3677.1.5: C 151 T, cne 1498. 4.1: C 82 A and in COI barcode: G 200 A, T 367 C, A 451 C, T 526 A, T 542 C. Barcode sequence of the holotype. Sample NVG- 22117 C 08, GenBank PP 254254, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGTATAATAGGAACATCTCTTAGTTTATTAATTCGAATAGAATTAGGAACTCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTTACAGCTCATGCATTTATTATAATTTTTTTTATAATTATACCTATTATAATTGGAGGATTTGGAAACTGATTAATTCCATTAATATTAGGAGCTCCAGATATAGCTTTCCCCCGTA TAAATAATATAAGATTTTGATTATTACCTCCTTCTTTATTTTTATTAATCTCCAGAAGAATTGTTGAAAATGGAGCAGGAACTGGATGAACAGTGTACCCCCCACTTTCATCTAATATTGC TCACAGAGGAACTTCTGTTGATTTAGCCATTTTTTCTCTTCATTTAGCTGGAATTTCATCAATCTTAGGTGCAATTAATTTTATTACCACTATTATTAATATACGTATTAATAATTTATCA TTTGATCAAATACCTTTATTTGTTTGATCTGTAGGAATTACAGCTCTTCTTCTTTTACTATCATTACCTGTTTTAGCAGGAGCTATTACTATATTACTTACTGATCGAAATTTAAATACAT CTTTTTTTGATCCTGCAGGAGGTGGAGATCCAATTTTATATCAACATTTATTT	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFF8FF9AE1FBABAB7490309B.taxon	materials_examined	Type material. Holotype: ♂ currently deposited in the collection of Museum für Naturkunde, Berlin, Germany [MFNB], illustrated in Fig. 17 b, bears four printed (text in italics handwritten): three white [Bahia, Para | Sello | Sieber / Hist. Coll. | Nr. 3827] (text after / is on the other side of the label), [ex coll. | H. STICHEL], [DNA sample ID: | NVG- 22117 C 08 | c / o Nick V. Grishin], and one red [HOLOTYPE ♂ | Synargis | tenebritorna Grishin]. The 1 st label of the holotype was added during the subsequent curation of historical collections by Andree Salk. Originally, the holotype was an unlabeled specimen in a series with the handwritten header label [Regulus | Fan God Don. | Baeotis Regulus | Wstw | Bah. Sello, Pará Sieb] on the specimen bearing a label with the number 3827 (a paratype of the species described next). Some specimens in this series are from Bahia, and others from Pará. The series consists of two species. The second species (described next) is Amazonian, and we deduce that it was collected in Pará by Friedrich Wilhelm Sieber (1775 – 1831). Therefore, we hypothesize that this species was collected in Bahia, Brazil, by Friedrich Sello [w] (1789 – 1831). Paratypes: 1 ♂ from Brazil, Maassen collection (NVG- 21119 F 09) and 1 ♀ no data, Weymer collection (NVG- 21119 F 10), both in MFNB. Type locality. Brazil: Bahia.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFF8FF9AE1FBABAB7490309B.taxon	etymology	Etymology. In Latin, tenebrosus means dark and describes something full of shadows or gloom, emphasizing the atmosphere of darkness. The name is a compound word of tenebrosus and tornus to indicate the dark ventral hindwing tornus. The name is an adjective.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFF8FF9AE1FBABAB7490309B.taxon	distribution	Distribution. Brazil, specifically recorded from Bahia. http: // zoobank. org / 986 F 2867 - 69 C 7 - 416 F- 8 B 88 - FA 3092 BBFAC 6 (Figs. 15 part, 17 c, d)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFF8FF9AE1FBABAB7490309B.taxon	diagnosis	Definition and diagnosis. Genomic analysis of the S. regulus group reveals a clade that, being distinct from all other species, itself consists of three species-level undescribed taxa (Fig. 15 red, purple, and orange). The first species (Fig. 15 orange) with specimens sequenced from French Guiana and Brazil: Pará differs in COI barcode by 2.0 % (13 bp) from S. tenebritorna sp. n. from and by 2.6 % (17 bp) from S. flavicauda sp. n. This new species is differentiated from its relatives by narrower than in some others yellow bands and submarginal macules, discal band at least twice the width of the submarginal band and macules (the hindwing discal band is even broader comparatively to the submarginal band in the paratype, Fig. 17 d), weakly developed marginal yellow spots inside brown border on the ventral side of wings, and the spot in cell M 3 - CuA 1 that is either missing or vestigial at least on the forewing, darker tornal area on ventral hindwing is visible but weaker than in S. tenebritorna sp. n. Males could be with dorsally yellow caudal half of abdomen (yellow ventrally as in other species). Due to unexplored phenotypic variation, definitive identification is provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome: cne 1775.24.4: C 93 A, cne 5268.4.1: T 390 C, cne 656.6.1: C 168 T, cne 5798.2.3: T 168 C, cne 2799.9.1: A 501 G, cne 8392.1.3: G 87 A, cne 5383.1.4: A 156 G, cne 5265.4.1: G 5775 A, cne 11854.1.1: A 493 G, cne 6377.3.2: T 159 T (not C) and in COI barcode: G 87 A, A 409 G, T 487 C, T 526 T, T 542 C. Barcode sequence of the holotype. Sample NVG- 22117 C 04, GenBank PP 254255, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGTATAGTAGGAACATCTCTTAGTTTATTAATTCGAATAGAATTAGGAACTCCTGAATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTTACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAACTGATTAGTTCCATTAATATTAGGAGCTCCAGATATAGCTTTTCCCCGTA TAAATAATATAAGATTTTGATTATTACCTCCTTCTTTATTTTTATTAATCTCCAGAAGAATTGTTGAAAATGGAGCAGGAACTGGATGAACAGTGTACCCCCCACTTTCATCCAATATTGC TCATAGAGGAACTTCTGTTGATTTAGCCATTTTTTCTCTTCATTTGGCTGGAATTTCATCAATCTTAGGTGCAATTAATTTTATTACCACTATTATTAATATACGTATTAATAATTTATCA TTCGATCAAATACCTTTATTTATTTGATCAGTAGGAATTACTGCTCTTCTTCTTTTACTATCATTACCTGTTTTAGCTGGAGCTATTACTATATTACTTACTGATCGAAATTTAAATACAT CTTTTTTTGATCCTGCAGGAGGTGGAGATCCAATTTTATATCAACATTTATTT	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFF8FF9AE1FBABAB7490309B.taxon	materials_examined	Type material. Holotype: ♂ deposited in the collection of Museum für Naturkunde, Berlin, Germany [MFNB], illustrated in Fig. 17 c, bears four labels, 2 nd handwritten on glassine paper likely cut out of the envelope that contained this specimen, others printed: three white [French Guyana | Roura, Galion | 28.04.1991 | leg. C. Brévignon], [28. IV. 1991 | Galion] (has other marks), [DNA sample ID: | NVG- 22117 C 04 | c / o Nick V. Grishin], and one red [HOLOTYPE ♂ | Synargis | latidifa Grishin]. Paratype: 1 ♂ from Brazil: Pará, F. Sieber leg. (NVG- 22117 C 06, GenBank barcode PP 254256; the header specimen with the historical collection number label 3827; see the type material section of the previous species for the deduction of the locality of this specimen, Fig. 17 d) [MFNB]. Type locality. French Guiana: Roura, Galion.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFF8FF9AE1FBABAB7490309B.taxon	etymology	Etymology. In Latin, latitudinum differentia means " difference in width, " referring to the widths of the discal (broader) and submarginal (narrow) bands: lati [tudinum] + dif [ferenti] a. The name is an adjective.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFF8FF9AE1FBABAB7490309B.taxon	distribution	Distribution. Lower Amazonian region; recorded from Brazil: Pará and French Guiana.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFF9FF95E251AC647546339C.taxon	type_taxon	Type species. Lycaena astraea Freyer, 1851. Definition. Nuclear genome phylogeny reveals that Glaucopsyche astraea (Freyer, 1851) (type locality in Turkey, syntype sequenced as NVG- 22119 A 10) is sister to all other species of Glaucopsyche Scudder, 1872 (type species Polyommatus lygdamus E. Doubleday, 1841), including type species of all its subgenera and their available synonyms: Polyommatus lygdamus E. Doubleday, 1841 of Glaucopsyche Scudder, 1872; Lycaena catalina Reakirt, 1866 (a junior subjective synonym of Lycaena piasus Boisduval, 1852) of Phaedrotes Scudder, 1876; Polyommatus melanops Boisduval, 1828 of Apelles Hemming, 1931; Glaucopsyche (Sinia) leechi Forster, 1940 of Sinia Forster, 1940; Lycaena barine Leech, 1893 (a subspecies of Lycaena divina Fixsen, 1887) of Shijimiaeoides Beuret, 1958; and Lycaena argali Elwes, 1899 of Bajluana Korshunov, 1990 (Fig. 18 a). We note that Phaedrotes (a subgenus of G. piasus) that causes problems by rendering Glaucopsyche paraphyletic in trees inferred from a small number of gene markers, especially when using a larger fraction of positions from mitochondrial genes (Nazari et al. 2024) or complete mitogenomes (Fig. 18 b), is closer related (with 100 % statistical support) to the subgenus Glaucopsyche than G. astraea. In agreement with morphological considerations, Glaucopsyche is monophyletic in the nuclear genome tree, with G. astraea being its most divergent member. Therefore, G. astraea is not monophyletic with any described subgenera of Glaucopsyche and does not belong to any of them. Hence, its lineage represents a new subgenus. This new subgenus differs from its relatives by ventrally not darkened marginal area and submarginal spots in forewing cells M 3 - CuA 1 and CuA 1 - CuA 2 being closer to the margin than in other species and forming a line nearly parallel to the outer margin, while the other three spots of the band are in a straight line with each other and the 4 th spot (in cell M 3 - CuA 1), i. e., the spot nearest to costa is not offset from the rest. In DNA, a combination of the following characters is diagnostic in the nuclear genome: cce 62262.1.1: A 120 T, cce 62262.1.1: C 123 T, cce 748.19.2: C 39 T, cce 748.19.2: T 78 C, cce 2404.9.1: C 165 T and in COI barcode: A 34 T, A 94 T, T 448 C, T 484 C, T 598 C.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFF9FF95E251AC647546339C.taxon	etymology	Etymology. The name of the type species likely refers to Astraea (Ἀστραῖα), a Greek goddess of justice, innocence, purity, and precision. A different spelling of this name (Astria) is taken as the genus name, which is a feminine noun in the nominative singular. Species included. Only the type species (i. e., Lycaena astraea Freyer, 1851). Parent taxon. Genus Glaucopsyche Scudder, 1872.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFF9FF95E251AC647546339C.taxon	discussion	Comment. Glaucopsyche is an example of confident incongruence between nuclear and mitochondrial genomes (Fig. 18 a vs. b) with subgenera Phaedrotes and Astria subgen. n. not being in the same clade as the rest of the genus in the mitogenomic tree, probably due to mitochondrial introgression. Further studies of this incongruence will shed light on the role of hybridization in speciation and adaptation.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFF7FF94E23FA98C736032BC.taxon	type_taxon	Type species. Lycaena metophis Wallengren, 1860. Definition. As genomic analysis demonstrates, all species of Oraidium Bethune-Baker, 1914 (type species Lycaena barberae Trimen, 1868) and Brephidium Scudder, 1876 (type species Lycaena exilis Boisduval, 1852) (Fig. 19) partition into three groups approximately equidistant from each other (Fig. 19). Above, we proposed to treat Oraidium as a subgenus of Brephidium, which may render Brephidium paraphyletic (Fig. 19). To avoid possible non-monophyletic taxa, the third groups should also be given a rank of subgenus. This new subgenus differs from Oraidium by its aedeagus, which is not saddle-shaped in its internal part but is bulbous, and the external part is similar to a small beak (shorter than the internal part) and not divided into two long (about twice the length of the internal part in O. barberae) and slender processes; and from both Oraidium and Brephidium by the tegumen lobe, which is with the terminal process not as long and rod-like as in Oraidium, and is broader and bulkier than in Brephidium, terminally with five shorter bristles (not two longer ones), and the base dorsally with a hump (not a lobe as in Oraidium and not a hook-like process with sharp small teeth as in Brephidium). For further details about the morphology of these species and illustrations of their genitalia see Bethune-Baker (1914) and Stempffer (1967). In DNA, a combination of the following characters is diagnostic in the nuclear genome: cce 22066.7.13: A 106 C, cce 462.35.4: G 159 A, cce 10386.1.3: C 46 T, cce 1353.3.2: A 63 T, cce 2452.1.6: C 78 T and in COI barcode: A 88 T, T 127 C, T 163 A, A 202 G, T 616 C.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFF7FF94E23FA98C736032BC.taxon	etymology	Etymology. The name reflects the Afrotropical distribution of this subgenus and is formed similarly to Brephidium and Oraidium: Afro [tropical Breph] idium. The name is a neuter noun in the nominative singular. Species included. Only the type species (i. e., Lycaena metophis Wallengren, 1860). Parent taxon. Genus Brephidium Scudder, 1876.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFF4FF97E103AAE6725B3187.taxon	description	As a result of the genomic analysis, we suggest that the type locality of P. comyntas Godart is likely in California and not in the eastern USA, and propose that Lycaena sissona W. G. Wright, 1905, syn. nov. is a junior subjective synonym of Cupido comyntas (Godart, [1824]). Visual assessment of the syntypes’ wing pattern agrees with this conclusion: the ventral forewing nearly lacks marginal and submarginal spots towards the apex, and white framing of dark ventral spots is weakly defined. These characters were mentioned by Austin (2002) to distinguish C. comyntas sissona from other subspecies. To stabilize nomenclature, N. V. G. hereby designates one of the two syntypes in MNHP, a male, bearing the following six rectangular labels, 1 st red, 4 th green, and others white: [TYPE], [comyntas, god. | ♂], [EVERES | COMYNTAS GOD.], [MUSÉUM PARIS], [DNA sample ID: | NVG- 23027 C 04 | c / o Nick V. Grishin], and [MNHN, Paris | EL 83734 {QR code}] as the lectotype of Polyommatus comyntas Godart, [1824]. The style and handwriting on the second label are characteristic of Godart’s type specimens, confirming this specimen as a syntype. The lectotype has a small nick at the apex of the right forewing and its head is rotated to the right.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFF5FF91E14FAA1F74B73162.taxon	description	(Figs. 20 part, 21)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFF5FF91E14FAA1F74B73162.taxon	diagnosis	Definition and diagnosis. As detailed above, the nominate Cupido comyntas (Godart, [1824]) is the western subspecies with a likely type locality in California. As a result, no available name applies to the eastern USA subspecies formerly known as “ Cupido comyntas comyntas ”. Only two names, both infrasubspecific, have been proposed for the eastern US populations. Everes comyntas ab. watermani Nakahara, 1926 (from New York, Tompkins Co., Ithaca) is infrasubspecific according to the ICZN Art. 45.6.2 because it refers to an aberration (" ab. ") (ICZN 1999). Everes comyntas f. meinersi W. D. Field, 1938 (from Kansas. Douglas Co. Lawrence) is infrasubspecific because, in accord with the ICZN Art. 45.6.4, the “ author expressly used … " f. " ” and “ also expressly gave it infrasubspecific rank ” by stating that “ This is the spring brood ” (Field 1938). According to the ICZN Glossary, “ infrasubspecific entity ” refers to “ Specimen (s) within a species differing from other specimens in consequence of intrapopulation variability … (e. g. … seasonal forms, … or … differing generations) ” (ICZN 1999). The spring brood is a different generation within a species and a seasonal form. Furthermore, the name meinersi has not been used as a valid name for a species or subspecies (Art. 45.6.4.1). Therefore, the eastern US subspecies of C. comyntas is new and is described here. The eastern subspecies (Fig. 20 green) is genetically differentiated from the nominate C. comyntas, which forms a clade sister to other populations (Fig. 20 purple), and the COI barcode difference between the western and eastern subspecies is 0.6 % (4 bp). The eastern subspecies is closer genetically to the southern Cupido comyntas texana (F. Chermock, 1945) (type locality USA: Texas, Bexar Co., near San Antonio) (Fig. 20 blue), but forms a clade distinct from it (Fig. 20 green), although their COI barcodes generally do not differ but by one or two base pairs. This new subspecies differs from other C. comyntas subspecies by the following characters: darker and browner (vs. grayer) ventral side of wings with more distinct whitish framing of dark spots; typically a complete row of marginal and submarginal spots beneath, particularly on the forewing (these spots are usually poorly expressed or lacking towards the apex in other subspecies); and brighter orange (vs. paler and yellower) ventral hindwing tornal crescents (Fig. 21). See further details in Austin (2002), who referred to C. comyntas comyntas by the name of its junior subjective synonym, sissona, and to the new subspecies as “ comyntas comyntas. ” A combination of the following DNA characters is diagnostic in the nuclear genome: cce 2265.4.2: G 66 A, cce 2896.5.6: A 57 G, cce 2896.5.6: T 84 G, cce 13103.2.4: C 74 T, cce 13103.2.4: C 59 A and in COI barcode differs from the nominate subspecies by: 412 A, 508 T, 556 A, 641 T (COI barcodes do not generally differ from C. comyntas texana). AACATTATATTTTATTTTTGGAATTTGAGCAGGAATATTAGGAACATCTTTAAGAATCTTAATTCGAATAGAATTAGGAACTCCAGGCTCATTAATTGGAGATGATCAAATTTATAATACT ATTGTCACAGCTCATGCTTTTATTATAATTTTTTTCATAGTAATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTACCATTAATATTAGGTGCTCCAGATATAGCATTTCCTCGAA TAAATAATATAAGATTTTGATTATTACCTCCATCATTAATATTATTAATTTCAAGAAGAATCGTAGAAAATGGAGCAGGAACAGGATGAACAGTGTACCCCCCACTTTCATCAAATATTGC CCATGGAGGATCATCTGTAGATTTAGCAATTTTTTCTTTACATTTAGCAGGAATCTCTTCAATTTTAGGAGCAATTAATTTTATTACAACTATTATTAATATACGAGTTAATAATTTATCA TTTGATCAAATATCTCTATTTATTTGAGCTGTAGGAATTACAGCATTATTATTATTATTATCATTACCTGTATTAGCTGGGGCTATTACAATATTATTAACTGATCGAAATTTAAATACCT CATTTTTTGATCCTGCTGGAGGAGGAGACCCAATCTTATATCAACATTTATTT	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFF5FF91E14FAA1F74B73162.taxon	materials_examined	Type material. Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity, Florida Museum of Natural History, Gainesville, FL, USA [MGCL], illustrated in Fig. 21, bears five printed labels: four white [NC: Mecklenburg Co. | Charlotte, W. Arrowood Rd & | Green Ridge Dr, near Sugar Creek May 20, 2022 | Leg: W. Dempwolf], [Cupido comyntas | ♂ | Coll of: W R Dempwolf], [DNA sample ID: | NVG- 22058 F 01 | c / o Nick V. Grishin], [WRD 20,914], and one red [HOLOTYPE ♂ | Cupido comyntas | orientalis Grishin]. Paratypes: 6 ♂♂ and 4 ♀♀ from USA: 1 ♂ Virginia, Rockingham Co., Briery Branch Rd., 7.3 mi WNW Briery Branch, GPS 38.4734, − 79.2042, 07 - May- 2016, N. V. Grishin & Q. Cong leg. (NVG- 6090); 1 ♀ Indiana, Montgomery Co., Shades State Park, 39.9312, − 87.0666, N. V. Grishin, 1 - Aug- 2015 (NVG- 4239); 1 ♂ Arkansas, Montgomery Co., Ouachita National Forest, Big Brushy Creek, along NF 6, GPS 34.6589, − 93.8345, 4 - Jul- 2015, N. V. Grishin leg. (NVG- 3888); 1 ♂ Oklahoma, Atoka Co., McGee Creek, GPS 34.3737, − 95.8886, 11 - Jul- 2017, N. V. Grishin leg. (NVG- 9270); and Texas: 1 ♀ Marion Co., Caddo Lake region, along SH 43, GPS 32.7957, − 94.1755, 20 - Jun- 2015, N. V. Grishin leg. (NVG- 3694); 1 ♂ Wise Co., LBJ National Grassland, Cottonwood Lake, GPS 33.3828, − 97.5719, 19 - Jul- 2015, N. V. Grishin leg. (NVG- 4182); 1 ♀ Hardin Co, 4.4 mi SW Kountze, along FM 770, GPS 30.3389, − 94.3678, 7 - Jun- 2015, N. V. Grishin leg. (NVG- 3506); Travis Co., Barton Creek Greenbelt, Camp Craft Road entrance, 28 - Mar- 2016, W. R. Dempwolf, leg.: 1 ♂ (NVG- 22088 H 04, WRD 9243) and 1 ♀ (NVG- 22088 H 05, WRD 9244); and 1 ♂ Blanco Co., USH 281 ca. 1 mi N of USH 290, 3 - Oct- 2015, W. R. Dempwolf, leg. (NVG- 22088 H 03, WRD 3649). Type locality. USA: North Carolina, Mecklenburg Co., Charlotte, W. Arrowood Rd. and Green Ridge Dr. near Sugar Creek.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFF5FF91E14FAA1F74B73162.taxon	etymology	Etymology. In Latin, orientalis means eastern. This way, the eastern Eastern Tailed Blue gets its eastern name. The name is an adjective.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFF5FF91E14FAA1F74B73162.taxon	distribution	Distribution. In the eastern half of the USA, southwards to central Texas and Florida.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFF3FF90E232AEEA723932B7.taxon	description	Four new species of Euriphellus Austin, 2008 (type species Papilio euribates Stoll, 1782) have been recently proposed: E. panamicus Grishin, 2023 (type locality in Panama: Panama), E. panador Grishin, 2023 (type locality in Ecuador: Esmeraldas), E. colombiensis Grishin, 2023 (type locality in Colombia: Río Dagua), and E. ecuadoricus Grishin, 2023 (type locality in Ecuador: Canelos) (Zhang et al. 2023 a; Zhang et al. 2023 d), but not all of them have been included together in the same phylogenetic tree. Here we show genome-based phylogeny of all known Euriphellus species (Fig. 23). The genus partitions into two distinct clades: the E. euribates group that consists of three species: E. cebrenus (Cramer, 1777) (type locality in Suriname), E. euribates (Stoll, 1782) (type locality in Suriname), and E. polygius (Latreille, [1824]) (type locality in South Brazil, as deduced by genomic sequencing) and the E. phraxanor group that includes all other species. Euriphellus cebrenus and E. euribates could be conspecific (Zhang et al. 2022 b) pending further research and possible neotype designations. We find that the three trees are incongruent in the E. phraxanor group. However, the topology of the Z chromosome tree is not strongly supported (Fig. 23 b). Most notable irregularities are in the mitochondrial genome tree (Fig. 23 c): E. panador and E. colombiensis essentially share the mitochondrial DNA, despite not being sisters in the nuclear genome, and E. lama (Evans, 1952) (type locality in Guatemala) is similar to them while being a more distant species according to the nuclear genome. Comparing the topologies of the three trees, we hypothesize that E. colombiensis and E. lama experienced mitochondrial DNA introgression from E. panador but at different time points.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFF1FFADE1BEA8AE737C3009.taxon	description	(Figs. 24 part, 25)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFF1FFADE1BEA8AE737C3009.taxon	diagnosis	Definition and diagnosis. Genome-based phylogeny places one specimen from Oaxaca, Mexico, tentatively identified by us as Heliopetes (Heliopetes) lana Grishin, 2023 (type locality in Guatemala) as sister to the clade of three species: H. lana, Heliopetes alana (Reakirt, 1868) (type locality in Colombia), and Heliopetes chimbo Evans, 1953 (type locality in Ecuador) (Fig. 24) and, therefore, represents a species distinct from them. The COI barcode of the new species differs by 2.1 % (14 bp) from H. lana, 1.7 % (11 bp) from H. alana, and 1.8 % (12 bp) from H. chimbo. Curiously, the geographically closest and possibly sympatric H. lana has the COI barcode most different from the new species. This new species keys to H. alana (G. 2.12) in Evans (1953) and differs from its relatives by better defined and larger pale triangles with sharper points at the outer margin of the ventral forewing, particularly at the apex, and brownish gray anal fold on the dorsal hindwing (typically white in H. lana and H. alana) (Fig. 25). Because the phenotypic variation of this species has not been explored, definitive identification is provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome: aly 2532.4.3: A 174 G, aly 2532.4.3: T 345 A, aly 2532.4.3: C 360 T, aly 2532.4.3: A 363 G, aly 2633.1.13: T 141 C, aly 259.26.1: C 599 C (not G), aly 259.26.1: T 619 T (not C), aly 235.14.1: C 2784 C (not T), aly 235.14.1: A 2829 A (not G), aly 1603.14.1: A 294 A (not G) and in COI barcode: C 3 T, C 133 T, T 178 T, T 235 T, T 376 A, C 610 T, T 613 T. Barcode sequence of the holotype: Sample NVG- 22105 D 09, GenBank PP 254258, 658 base pairs: AATTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGTACTTCTTTAAGTTTATTAATTCGAACTGAATTAGGAAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTCATAGTAATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATATTAGGAGCCCCAGATATAGCATTTCCTCGTA TAAATAATATAAGATTTTGACTTTTACCCCCATCCCTAACATTATTAATTTCAAGAAGTGTAGTAGAAAATGGAGCAGGAACTGGTTGAACAGTTTACCCCCCTCTCTCGGCTAATATCGC CCATCAAGGATCATCTGTTGATTTAGCTATTTTTTCTTTACATTTAGCTGGAATTTCATCTATCTTAGGAGCTATTAATTTTATTACAACTATTATTAATATACGTATTAGAAATATATCA TTTGACCAAATACCTTTATTTGTATGAGCAGTAGGAATTACTGCTTTATTACTACTATTATCATTACCTGTTTTAGCAGGTGCTATTACAATATTATTAACAGATCGAAATTTAAATACAT CATTTTTTGATCCTGCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTC	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFF1FFADE1BEA8AE737C3009.taxon	materials_examined	Type material. Holotype: ♂ deposited in the California Academy of Sciences, San Francisco, CA, USA [CAS], illustrated in Fig. 25, bears seven printed (dates and the species name on the 4 th label handwritten): six white [MEX.: Oaxaca, | Candelaria Loxicha | 500 m; IX- 15 - 73], [rec’d from | P. Hubbell], [Collection of | C. D. MacNeill], [Heliopetes | alana (Reak.) | Det. C. D. MacNeill ' 75], [DNA sample ID: | NVG- 22105 D 09 | c / o Nick V. Grishin], [{QR Code} CASENT | 8568387], and one red [HOLOTYPE ♂ | Heliopetes (Heliopetes) | acuta Grishin]. Type locality. Mexico: Oaxaca, Candelaria Loxicha.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFF1FFADE1BEA8AE737C3009.taxon	etymology	Etymology. In Latin, acutus means sharp, pointed, or keen, from which we form the noun acuta and use it in apposition. The name refers to sharp and pointed marginal white triangles on the ventral forewing of this species.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFF1FFADE1BEA8AE737C3009.taxon	distribution	Distribution. Known only from Oaxaca in Mexico.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFCEFFAFE1A5AF31747E3734.taxon	description	To stabilize nomenclature, N. V. G. hereby designates the specimen in MFNB shown in Fig. 26 a, a male, bearing the following five rectangular white labels, 3 rd and 5 th printed, others handwritten: [cnidus NVG- 21115 E 07 | c / o Nick V. Grishin] as the lectotype of Achlyodes cnidus Plötz, 1884. The lectotype has a fingerprint mark at the left forewing apex and is missing a part of the right hindwing fringe towards the tornus. The number 161 likely refers to the Weymer collection, and we were not able to associate it with any published information. The label 75: 5 gives a genus number (75 - Gindanes) and a species number (5 - cnidus) in the Mabille catalog (Mabille 1903) that was used as a guide to arranging the Hesperiidae collection in Berlin. The type locality that was not specified in the original description and not given on the lectotype labels remains unknown and will eventually be deduced by genomic sequencing and comparison with G. cnidus specimens from known localities. Genomic sequencing of the A. cnidus lectotype does not place it close to G. phisara but instead revealed that it is distant from other Gerosis Mabille, 1903 (type species Coladenia hamiltoni Nicéville, 1889, currently treated as a junior subjective synonym of Satarupa phisara (Moore, 1884) (Fig. 27). Therefore, we propose that Gerosis cnidus (Plötz, 1884), stat. rest. is a valid species distinct from Gerosis phisara (Moore, 1884) in particular, and from other Gerosis in general. Because we sequenced only one specimen of Gerosis cnidus, it remains unclear whether its unique for Gerosis wing pattern is an aberration as suggested by Evans (1949) or a color morph (in which case the typical striped and spotted form has not been found yet), or represents the typical (and the only?) wing pattern form of this species. Although we have not sequenced type specimens of Coladenia hamiltoni Nicéville, 1889 (type locality in Bangladesh: Sylhet) and Caprona? kuki Tytler, 1915 (type locality in India: Lushai Hills), due to their wing pattern similarity with G. cnidus, we propose to treat them as its junior subjective synonyms instead of keeping them as synonyms of Gerosis phisara, pending further research. As a result of this analysis, the valid name for the type species of Gerosis becomes Gerosis cnidus (Plötz, 1884), stat. rest., and we hypothesize that its type locality is in eastern India or Bangladesh. If the wing pattern of G. cnidus represents an unusual color morph, this morph may be present in other species of Gerosis, in which case C. hamiltoni and / or C. kuki might be some species other than G. cnidus.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFCCFFAEE203A83B74653380.taxon	diagnosis	Definition and diagnosis. Genomic analysis of an unusually patterned specimen from Goiás Brazil (Fig. 29) somewhat resembling Metrocles schrottkyi (Giacomelli, 1911) (type locality in Argentina) (Fig. 30 b) in its wing pattern and a tri-partite brand that is nearly shaped into a stigma, places it in Metrocles Godman, 1900 (type species Metrocles leucogaster Godman, 1900) sister to Metrocles argentea (Weeks, 1901) (type locality in Bolivia) (Fig. 28). This specimen represents a new species that differs from all similar species by a combination of a nearly straight white discal band on reddish-brown ventral hindwing with its white inner margin that continues along the sides of the thorax, behind the eyes and onto the collar, thus forming a continuous hairpin-shaped white framing from tornus of one hindwing to the other, and the lack of white spots in the forewing discal cell. Metrocles schrottkyi lacks this white hairpin framing. In DNA, a combination of the following characters is diagnostic in the nuclear genome: aly 2850.3.4: C 63 T, aly 103.44.1: C 60 T, aly 1591.7.3: T 331 C, aly 127.37.1: G 699 A, aly 127.37.1: C 721 A, aly 2850. 3.4: C 75 C (not T), aly 6398.4.4: G 66 G (not A), aly 6398.4.4: C 72 C (not G), aly 499.16.2: C 159 C (not T), aly 3268. 8.1: C 138 C (not T) and in COI barcode: T 49 C, T 197 C, T 235 C, T 529 A, T 595 C. Barcode sequence of the holotype. Sample NVG- 18117 A 01, GenBank PP 254259, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCCCTAAGATTATTAATTCGAACTGAATTAGGAGCTCCTGGATCATTAATTGGAGATGATCAAATTTATAATACT ATTGTTACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGACTAGTTCCTTTAATATTAGGAGCTCCTGATATAGCATTCCCTCGAA TAAATAATATAAGATTTTGAATATTACCCCCATCATTAACTTTATTAATTTCTAGAAGAATTGTAGAAAATGGTGCAGGTACTGGTTGAACAGTTTATCCTCCTTTATCTTCTAATATTGC CCATCAAGGATCTTCTGTTGATTTAGCAATTTTTTCACTTCATTTAGCTGGTATCTCATCAATCTTAGGAGCTATTAACTTTATCACAACAATTATTAATATACGAATTAGAAATATATCA TTTGATCAAATACCTTTATTTGTATGATCTGTAGGAATTACAGCATTATTATTACTTTTATCTTTACCTGTTCTAGCTGGAGCTATTACTATATTACTTACTGATCGAAACTTAAATACTT CATTTTTTGATCCTGCTGGAGGAGGTGATCCTATTTTATATCAACATTTATTT	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFCCFFAEE203A83B74653380.taxon	materials_examined	Type material. Holotype: ♂ currently deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA [USNM], illustrated in Fig. 29, bears seven printed labels (text in italics handwritten): six white [24 kil. E. Formoso, | Go., Brazil | May 16, 1956 | F. S. Truxal], [MACHRIS BRAZILIAN | EXPEDITION – 1956 | LOS ANGELES | COUNTY MUSEUM], [genitalia | slide / vial # | H 78 | Prep. S. S. Nicolay], [Chalcone | zisa ♂ | Det. Plotz | S. S. Nicolay], [DNA sample ID: | NVG- 18117 A 01 | c / o Nick V. Grishin], [USNMENT | {QR Code} | 01531662], and one red [HOLOTYPE ♂ | Metrocles | nun Grishin]. Type locality. Brazil: Goiás, 24 km east of Formoso.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFCCFFAEE203A83B74653380.taxon	etymology	Etymology. A resting individual of this species, with its dark color and white framing from collar to tornus, resembles a nun (Fig. 30 a), hence the name, which is a noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFCCFFAEE203A83B74653380.taxon	distribution	Distribution. Currently known from Central Brazil.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFCCFFAEE203A83B74653380.taxon	discussion	Comments. Although we have not yet sequenced M. schrottkyi (Fig. 30 b), querying the BOLD database (Ratnasingham and Hebert 2007) with COI barcodes of our sequenced specimens reveals that it is a species different from either Metrocles scitula (Hayward, 1951) (type locality in Brazil: Mato Grosso) and this new species, although closely related to them (~ 2.5 % difference).	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFCDFFA8E214ACBC75263145.taxon	description	(Figs. 31 part, 32)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFCDFFA8E214ACBC75263145.taxon	diagnosis	Definition and diagnosis. Genomic analysis of Hedone Scudder, 1872 (type species Hesperia brettus Boisduval & Le Conte, [1837], a junior subjective synonym of Thymelicus vibex Geyer, 1832) reveals that a female collected north of Lima in Peru is sister to Hedone mira Grishin & Lamas, 2022 (type locality in Peru: Apurímac) but is genetically differentiated from it at the species level (Fig. 31), e. g., their COI barcodes differ by 2.4 % (16 bp). Therefore, this female represents a new species. This new species differs from other Hedone species (except H. mira) by rusty-colored ventral hindwing with a yellowish broken discal band and only slightly scalloped dark outer border of forewing, and differs from H. mira by redder and broader (but not as broad and continuous as in Hedone bittiae (Lindsey, 1925), type locality in Peru) discal band on ventral hindwing, more diffuse marginal brown on dorsal hindwing blending with orange ground color, smaller forewing subapical spots, and submarginal spots more offset towards the forewing margin. Due to unexplored phenotypic variation, definitive identification is provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome: aly 103.11.2: C 760 T, aly 103.11.2: A 1569 G, aly 159.18.1: T 114 A, aly 159.18.1: C 198 T, aly 499.1.3: G 42 A, aly 1487.2.21: G 57 G (not A), aly 1487.2.21: C 60 C (not A), aly 577.49.5: A 174 A (not G), aly 331.3.6: C 165 C (not T), aly 569.1.2: C 109 C (not T) and in COI barcode: T 124 C, T 284 C, T 343 A, T 532 A, T 596 C. Barcode sequence of the holotype. Sample NVG- 22102 C 03, GenBank PP 254260, 658 base pairs: AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACTTCCTTAAGTTTATTAATTCGAACAGAATTAGGTAATCCTGGTTCTTTAATTGGAGATGATCAAATTTATAATACT ATCGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCATTAATATTAGGAGCTCCTGATATAGCTTTTCCTCGAA TAAATAACATAAGATTTTGAATATTACCTCCTTCACTAACACTATTAATTTCAAGAAGAATTGTAGAAAATGGTGTAGGAACAGGTTGAACAGTTTATCCACCTTTATCTTCTAATATTGC TCATCAAGGATCTTCTGTTGATTTAGCAATTTTTTCTCTTCATTTAGCTGGAATTTCTTCTATTTTAGGAGCTATTAATTTTATTACAACAATTATCAATATACGAATTAAAAATTTATCT TTTGATCAAATACCTTTATTTGTATGATCTGTTGGAATTACAGCTCTATTATTATTATTATCTTTACCTGTTTTAGCTGGAGCTATTACTATATTACTTACAGATCGAAATCTAAATACTT CTTTTTTTGATCCAGCTGGAGGAGGAGATCCAATCTTATATCAACATTTATTT	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFCDFFA8E214ACBC75263145.taxon	materials_examined	Type material. Holotype: ♀ currently deposited in the California Academy of Sciences, San Francisco, CA, USA [CAS], illustrated in Fig. 32, bears seven labels, 3 rd and 4 th handwritten (below, text in italics handwritten) and others printed: six white [Chancay, | PERU. III- 15 - 51 | River valley], [Ross and | Michelbacher | Collectors], [♀ 6113 | P. vibex? | C. D. MACNEILL' 93], [Polites vibex | bittiae? LINDSEY | Det. C. D. MacNeill ' 93], [DNA sample ID: | NVG- 22102 C 03 | c / o Nick V. Grishin], [{QR Code} CASENT | 8566975], and one red [HOLOTYPE ♀ | Hedone miracla | Grishin]. Type locality. Peru: Lima Department, ~ 80 km north of Lima, Chancay River valley.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFCDFFA8E214ACBC75263145.taxon	etymology	Etymology. The name is formed from the sister species, H. mira, and is a noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFCDFFA8E214ACBC75263145.taxon	distribution	Distribution. Currently known only from the holotype collected in coastal Peru north of Lima.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFCBFFABE0A8AEE171D9344A.taxon	description	Genomic comparison of subspecies of Vettius phyllus (Cramer, 1777) (type locality in Suriname) reveals that Vettius phyllus prona Evans, 1955 (type locality in Brazil: São Paulo) is genetically differentiated from others at the species level (Fig. 34), e. g., its COI barcode differs from the nominate V. phyllus by 2 % (13 bp). Therefore, we propose that Vettius prona Evans, 1955, stat. nov. is a species distinct from Vettius phyllus (Cramer, 1777).	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
C45B002EFFC8FFAAE136AEB075633491.taxon	description	from Phlebodes fuldai (E. Bell, 1930) Genomic sequencing and analysis reveal that Vettius yalta Evans, 1955 (type locality in Brazil: Espírito Santo) is genetically differentiated from Euroto fuldai Bell, 1930 (type locality in Colombia: Simiti), currently in the genus Phlebodes Hübner, [1819] (type species Papilio pertinax Stoll, 1781), at the species level (Fig. 36), e. g., their COI barcodes differ by 4.3 % (28 bp). Therefore, we propose that Phlebodes yalta (Evans, 1955), stat. rest. is a species distinct from Phlebodes fuldai (E. Bell, 1930).	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): Taxonomic advances driven by the genomic analysis of butterflies. The Taxonomic Report of the International Lepidoptera Survey 11 (7): 1-43
