Macgrathphora caribbea new species
(Figs. 1, 5, 6, 11)
HOLOTYPE. ♂, slide mounted. BOLD specimen number GMACB559-15. COSTA RICA: Guanacaste: Área de Conservación Guanacaste, Sector San Cristobal, Estación San Gerardo, 10.88°N, 85.389°W, 575m, 9–16.ix.2013, D.Janzen, W. Hallwachs, Malaise trap (MUCR).
PARATYPES. COSTA RICA: Guanacaste: 5♂, same data as holotype (GMACB500-15, GMAC1001-15, GMACB1120-15, GMACB1332-15, GMACB509-15), 2♂, 26.viii.2013 (GMACA119-15, GMACA1049-15), 1♂, 23.ix. 2013 (GMACC287-15), 1♀, 7.x.2013 (GMACD010-15) (LACM, MUCR) . Heredia: Chilamate, 10.45°N, 84.08°W, 75 m , 1♂, v.1989, P. Hanson, Malaise trap (LACM); La Selva Biological Station, 10.43°N, 84.02°W, 40 m , 1♀, 1-6.vii.1993, B.Brown,D. Feener, Malaise trap CCL 850 (LACM), 1♂, 22-26.vi.1993, B.Brown,D. Feener, Malaise trap #4 (LACM), 1♀, 6-11.vii.1993, B.Brown,D. Feener, Malaise trap #4, SSO 50 (LACM) . Limon: 16km W Guapiles, 10.15°N, 83.92°W, 400 m , 1♂, 1♀, iii–v.1990, P. Hanson, Malaise trap (LACM) .
Diagnosis. The wing venation of this species is extremely distinctive, with vein Rs being more swollen than in the other species of the genus, and the relative costal ratios different (as in the key, below).
In BOLD, this species is in BIN BOLD:ACS8553. The nearest neighbor in BOLD, based on the CO1 DNA barcode, is a Holarctic Region species of Megaselia, identified as M. zonata in BIN BOLD:AAG3266. There are other species of Macgrathphora in the Neotropical Region, however, that have been barcoded (as discussed above) whose sequences should be closer to those of Macgrathphora caribbea (see M. longifurca new species, below).
The cluster width for the 175 sequences of this BIN in BOLD is 1.31%, and thus below the threshold established by Hartop et al. (2021) for concern about containing multiple species. I have not examined specimens from the entire range of haplotypes, however photographs on the BOLD site indicate that this species is congruent with this BIN.
Holotype DNA barcode:
AACTTTATATTTTATTTTCGGGGCTTGAGCAGGAATAGTGGGAACATCCCTAAGAATTATAATTCGAGC TGAATTAGGACACCCTGGTGCCTT------------ AATTGGAGATGACCAAATTTATAATGTTATTGTTACTGCTCATGCATTTATTATAATTTTTTTTATAGTTAT ACCTATCATAATAGGAGGATTTGGAAATTGATTAGTACCCTTAATATTAGGGGCCCCTGATATAGCATTT CCTCGAATAAATAATATAAGATTTTGATTACTCCCTCCTTCATTAACTTTACTATTGGCAAGCAGTATAGT AGAAAATGGGGCTGGTACCGGCTGAACAGTTTACCCTCCTCTATCCTCTAGAATTGCCCATAGAGGAG CGTCTGTAGATTTAGCAATTTTTTCTTTACATTTAGCCGGAATCTCCTCTATTTTAGGAGCGGTCAATTT TATTACTACTATTATTAATATACGCTCTTCTGGAATTACCTTTGACCGTATACCTTTATTTGTATGATCCGT AGGTATTACTGCAATTTTGCTACTACTCTCATTACCAGTGTTAGCCGGAGCAATTACAATATTACTAACA GACCGAAACTTTAATACTTCATTCTTCGACCCTGC-------
Distribution. This species is known from the Caribbean (eastern) slope rain forest of Costa Rica. BOLD records are all from Estación Biologica San Gerardo, as is the holotype. At 178 specimens, it was the ninth commonest phorid in the ACG project, and the second commonest from the Estación San Gerardo site.
Etymology. The species name caribbea refers to the Caribbean coastal rain forest of Costa Rica, where all specimens have been collected.