Aquieurochytrium Tedersoo & Esmaeilzadeh-Salestani gen. nov.

Type species.

Aquieurochytrium lacustre Tedersoo & Esmaeilzadeh-Salestani .

Diagnosis.

Distinguishable from other fungi based on diagnostic nucleotide signatures in ITS 2 (positions 160–168 ccgcgacga; one mismatch allowed) and LSU D 2 (positions 618–637 in type species and 591–610 in S. cerevisiae tcgcagcgcaccgtaaggcg). Forms a monophyletic, least inclusive clade in Aquieurochytriaceae, covering sequences EUK 1102113 and EUK 1102276 (Figs 1, 6).

Notes.

Recognized based on eDNA sequences only. Comprises potentially 25–30 species represented by sequences EUK 1102276 (lake water in Sweden), EUK 0569233 (lake water in Estonia), and EUK 0569237 (lake water in Benin).