Aldinomyces tarquinii Tedersoo sp. nov.

Diagnosis.

Separation from other species of Aldinomyces based on ITS 2 (positions 225–244 taaagaagatttcttcttta; two mismatches allowed) and LSU D 2 (positions 709–728 gcggctggacagctgtgcaa; one mismatch allowed) as indicated in Fig. 50. Intraspecific variation up to 1.1 % in ITS 2 and up to 0.4 % in LSU. Interspecific distance at least 3.9 % in ITS 2.

Type.

Vouchered soil sample TUE 002655 (holotype); eDNA sequence EUK 1205365 = OZ 253811 (legitype); eDNA sample TUE 102655 (nucleotype); GSMc plot S 1183, mixed forest in Aldino, Italy, 46.4072°N, 11.4964°E .

Description.

Other sequences: EUK 1205356 (type locality); EUK 1124394 (GSMc plot G 5912, temperate grassland soil in Rahinge, Estonia, 58.3804°N, 26.6289°E); EUK 0320467 (FunAqua sediment sample W 0315 s in Cottonwood Lake, ND, USA, 47.1, – 99.09); EUK 0529885 (GSMc plot G 2838 X; tundra soil in Kvaenangsfjellet, Norway, 69.8972°N, 21.5778°E); and GlobalFungi accessions fa 0 dd 51 fb 77 b 34 cf 5 b 5659 d 5 f 4 d 674 c 1 (forest soil in Yunnan, China, 27.12°N, 100.17°E); ea 737611 f 71505778 a 4409 d 28 eec 463 d ( woodland soil in MT, USA, 45.3982, –110.704); and 5363 d 0 a 2 c 4815 da 4 d 7 fb 36 f 7 f 94 d 6 c 6 e (forest soil in Austria, 47.36°N, 15.05°E).

Etymology.

Aldino (Italian) refers to the type locality, and Tarquin (English) refers to Tarquin Netherway, who collected the material from the type locality.

Notes.

Found in three soil samples and one sediment sample in the Northern Hemisphere. GlobalFungi records (n = 12) confirm the distribution in soils of the Holarctic realm.