Aldinomyces Tedersoo gen. nov.

Type species.

Aldinomyces tarquinii Tedersoo .

Diagnosis.

Distinguishable from other fungi based on a diagnostic nucleotide signature in ITS 2 (positions 139–158 gcggatttcgaaagatttct in type species; one mismatch allowed). Forms a monophyletic, least inclusive clade in Aldinomycetaceae, covering sequences EUK 1205365, EUK 1124394, and EUK 0529911 (Figs 1, 49).

Notes.

Recognized based on eDNA sequences only. Comprises about four potential species represented by sequences EUK 0483667 (forest soil in Argentina), EUK 0138900 (forest soil in Norway), and EUK 0529911 ( woodland soil in Estonia).