Nematovomyces soinasteënsis Tedersoo sp. nov.

Diagnosis.

Separation from other species of Nematovomyces based on ITS 2 (positions 491–510 aaaaccctttttcccccaca; one mismatch allowed) and LSU (positions 601–620 tgttcttggtactgagttta; one mismatch allowed) as indicated in Fig. 56. Intraspecific variation up to 2.8 % in ITS 2 and up to 0.3 % in LSU. Interspecific distance at least 8.0 % in ITS 2.

Type.

Vouchered soil sample TUE 000860 (holotype); eDNA sequence EUK 1124397 = OZ 253814 (legitype); eDNA sample TUE 100860 (nucleotype); GSMc plot S 328, Betula pendula dominated forest in Soinaste, Estonia, 58.3322°N, 26.7678°E .

Description.

Other sequences: EUK 1200775 (GSMc plot S 1183, mixed forest soil in Aldino, Italy, 46.4072°N, 11.4964°E); EUK 1217250 (GSMc plot G 4679, Salix triandra swamp soil in Prangli Rivimaa, Estonia, 59.6151°N, 24.9871°E); EUK 0330847 (GSMc plot S 141, Carpinus- Quercus - Alnus forest soil in Shirgah, Iran, 36.2122°N, 52.8243°E); EUK 0483680 (GSMc plot G 4196, mixed forest soil in Kahvena, Estonia, 58.2799°N, 25.2316°E); EUK 1217249 (GSMc plot G 4800, Ulmus-Alnus temperate forest soil in Tuhkja, Estonia, 58.4159°N, 25.2327°E); EUK 033840 (GSMc plot S 939, tropical rainforest soil in Parotania, Bolivia, – 17.5815, – 66.3443°E); and EUK 0330843 (GSMc plot G 4030, Quercus-Arbutus forest soil in Ain Boumahdi, Morocco, 34.0096, – 4.2858, 24.9871°E).

Etymology.

Soinaste (Estonian) refers to the type locality.

Notes.

Found in forest soils in Eurasia, North Africa, Central Asia, and South America (n = 18 records). The 16 additional GlobalFungi records indicate occurrence in soil and root samples across various ecosystems and biomes in Spain, China, and the USA.