Terrincolales Tedersoo & Esmaeilzadeh-Salestani ord. nov.

Type family.

Terrincolaceae Tedersoo & Esmaeilzadeh-Salestani .

Diagnosis.

Distinguishable from other fungi based on diagnostic nucleotide signature in 5.8S (positions 6–26 in type species and S. cerevisiae ttcaacaatggatccctcg; no mismatch allowed), LSU D 1 (positions 4–23 in type species and S. cerevisiae tcctcaaatcaagcaagagt; no mismatch allowed), LSU D 2 (positions 255–264 in type species and 244–253 in S. cerevisiae ttggtagtgg; one mismatch allowed), and SSU V 3 (positions 647–651 ggcttg in S. cerevisiae; no mismatch allowed). Forms a monophyletic, least inclusive clade in Calcarisporiellomycetes, covering sequences MW 791967, EUK 1138132, EUK 1123677, EUK 0332618, EUK 1123675, EUK 1604147, EUK 1604155, and EUK 1123676 (Fig. 1).

Notes.

Recognized based on eDNA sequences only. Encoded as clade GS 94 in EUKARYOME v 1.9. Currently includes Terrincolaceae (fam. nov.) and a potentially family-level group represented by sequences EUK 1604147 (tundra soil in AK, USA) and EUK 1604155 (forest soil in LO, USA). Terrincolales comprises potentially 50–70 species. Detected exclusively in soil (100 % out of the 249 records) in tundra to hot tropical biomes across all continents, excluding Antarctica.