Tropicochytrium toronegroense Tedersoo sp. nov.

Diagnosis.

Separation from other species of Tropicochytrium based on ITS 2 (positions 182–201 gggggcctcgtctccccttt; one mismatch allowed) and LSU D 2 (positions 536–555 gaccccgccctcacgggtgg; no mismatch allowed) as indicated in Fig. 13. Intraspecific variation up to 2.1 % in ITS 2. Interspecific distance at least 3.1 % in ITS 2.

Type.

Vouchered soil sample TUE 002012 (holotype); eDNA sequence EUK 1186756 = OZ 253791 (legitype); eDNA sample TUE 102012 (nucleotype); GSMc plot G 5035; tropical rainforest soil in Toro Negro, Puerto Rico, 18.1770, –66.4884 .

Description.

Other sequences: EUK 0649723 (GSMc plot MX 35, Pinus chiapensis - dominated tropical forest, Mecacalvo, Veracruz, Mexico, 19.7760, –97.1016); EUK 0649724 (GSMc plot S 914, tropical forest in Lagos de Monte Bello, Chiapas, Mexico, 16.1004, –91.6871); EUK 0649725 (GSMc plot G 5037, tropical forest in Maricao, Puerto Rico, 18.1450, –66.9669); EUK 0137040, EUK 0474865 and EUK 0519433 (all GSMc plot S 381, tropical forest soil in Col Palmarena, Costa Rica, 10.2211, –84.5992); and EUK 0474859 and EUK 0519530 (both GSMc plot JYK 042, tropical forest soil in Barclayville, Liberia, 4.6777°N, 8.1230°E).

Etymology.

Tropica (Greek) refers to the tropics, where the genus mainly occurs; Toro Negro (Spanish) refers to the type locality.

Notes.

Found in soil in tropical rainforest habitats of Central America and West Africa (six localities). There are no additional GlobalFungi records.