Tropicochytrium Tedersoo gen. nov.

Type species.

Tropicochytrium toronegroense Tedersoo .

Diagnosis.

Distinguishable from other fungi based on diagnostic nucleotide signature in ITS 2 (positions 108–127 in type species ctcgtggtccgcaaggcttt; one mismatch allowed) and LSU D 2 (positions 557–577 in type species and 549–569 in S. cerevisiae agtttatagcctccggtcctg; one mismatch allowed). Forms a monophyletic, least inclusive clade in Tropicochytriaceae, covering sequences EUK 1186758, EUK 0519487, and EUK 1186756 (Figs 1, 12).

Notes.

Recognized based on eDNA sequences only. Comprises potentially 20–25 species represented by sequences EUK 0519487 (forest soil in the Philippines), EUK 1186758 (forest soil in Guadeloupe), EUK 1186753 (forest soil in Puerto Rico), and EUK 0131338 (grassland soil in Colombia).