Aquieurochytriaceae Tedersoo & Esmaeilzadeh-Salestani fam. nov.

Type genus.

Aquieurochytrium Tedersoo & Esmaeilzadeh-Salestani .

Diagnosis.

Distinguishable from other fungi based on diagnostic nucleotide signatures in LSU D 1 (positions 171–185 in type species and S. cerevisiae ggcaagccgggcaaa; one mismatch allowed), SSU V 4 (positions 871–885 in S. cerevisiae atactttcattagtc; one mismatch allowed), and ITS 2 (positions 173–195 in type species taatgctgggcgtcagcctgctt OR taatgacgggcgtcagcctgctt; three mismatches allowed). Forms a monophyletic, least inclusive clade in Aquieurochytriales, covering sequences AB 971081, EUK 1100022, EUK 1102113, EUK 1123700, and EUK 1102276 (Fig. 1).

Notes.

Recognized based on eDNA sequences only. Includes Aquieurochytrium (gen. nov.) and other potentially genus-level groups represented by sequences AB 971081 (water in Japan), EUK 1123700 (freshwater sediment in New Zealand), and EUK 1100022 (permafrost in Canada).