Palomastigales Tedersoo ord. nov.

Type family.

Palomastigaceae Tedersoo .

Diagnosis.

Distinguishable from other fungi based on diagnostic nucleotide signatures in SSU V 8 (positions 1664–1678 in S. cerevisiae tttagtgaggactcg; no mismatch allowed) and 5.8S (positions 116–135 in type species and S. cerevisiae gcctcccggtattccaggag or gcttcatggtattccgtga; one mismatch allowed). Forms a monophyletic, least inclusive clade in Palomastigomycetes, covering sequences EUK 1124846, EUK 1123686, EUK 0320705, and EUK 0320700 (Fig. 1).

Notes.

Recognized based on eDNA sequences only. Currently includes Palomastigaceae (fam. nov.).