Edaphochytriomycetes Tedersoo class. nov.
Type order.
Edaphochytriales Tedersoo .
Diagnosis.
Distinguishable from other fungi based on a diagnostic nucleotide signature in 5.8S (positions 45–64 in type species and S. cerevisiae catagtgaaatgtgataact or catggtgaaatgtgacaatt; one mismatch allowed). Forms a monophyletic, least inclusive clade in Chytridiomycota, covering sequences EUK 1104126, EUK 1107474, EUK 1671450, EUK 1671451, EUK 1008462, EUK 1200051, EUK 1101631, EUK 1101779, EUK 1200763, and EUK 1123748 (Fig. 1).
Notes.
Recognized based on eDNA sequences only. Encoded as clade GS 42 in EUKARYOME v 1.9. Currently harbors Edaphochytriales (ord. nov.) and potentially an order-level group represented by sequences EUK 1104126 (lake water in Sweden) and EUK 1107474 (peatland soil in Sweden). Comprises potentially 40–45 species. Detected in soil (94.4 % out of the 89 records), sediments (2.2 %), glacial ice (2.2 %), and freshwater (1.1 %) in tundra to wet tropical biomes across all continents except Antarctica.