Terrincola waldropii Tedersoo & Esmaeilzadeh-Salestani sp. nov.

Diagnosis.

Separation from other species of Terrincola based on diagnostic nucleotide signatures in ITS 2 (positions 359–383 atagatgggacccggtcgaggatca; one mismatch allowed) and LSU D 2 (positions 569–588 agtcctctatttgtacaatg; one mismatch allowed) as indicated in Fig. 28. Intraspecific variation up to 1.2 % in ITS 2 and up to 0.5 % in LSU sequences. Interspecific distance at least 4.9 % in ITS 2 and 3.9 % in LSU.

Type.

Vouchered soil sample TUE 000813 (holotype); DNA sequence EUK 1138132 = OZ 253800 (legitype); eDNA sample TUE 100813 (nucleotype); GSMc plot S 281, Quercus robur alley in Tartu, Estonia, 58.379°N, 26.706°E .

Description.

Other sequences: EUK 1138131 (GSMc plot G 5295, Pinus mugo plantation soil in Märja, Estonia, 58.3592°N, 26.6443°E); EUK 0326024 (GSMc plot S 1087, tundra soil in Zackenberg, Greenland, 74.4682, –20.6142); EUK 0326022 (GSMc plot G 5038, tropical dry forest soil in West End, British Virgin Islands, 18.3907, –64.7073); EUK 0326084 (GSMc plot S 639, subtropical forest soil in Platbos, South Africa, –34.5676, 19.4461); EUK 0326080 (GSMc plot S 618, montane desert soil in Tanglang La, India, 33.5051°N, 77.7655°E); EUK 0326071 (GSMc plot G 5769, temperate grassland soil in Rõõmu, Estonia, 58.3877°N, 26.7770°E); and DQ 421306 (temperate grassland soil in Cedar Creek, MN, USA, 45.40, – 93.19).

Etymology.

Terra and incola (Latin) refer to the soil habitat, and Waldrop (English) refers to the last name of Mark P. Waldrop, who was the first to collect material of this species and order (DQ 421306; Waldrop et al. 2006).

Notes.

All 109 records originate from soil. This is supported by GlobalFungi data, where> 98 % of 732 records are from soil and 1 % from roots. Found in all biomes and continents, excluding Antarctica.