Edaphochytrium Tedersoo gen. nov.

Type species.

Edaphochytrium valuojaense Tedersoo .

Diagnosis.

Distinguishable from other fungi based on a diagnostic nucleotide signature in 5.8S (positions 114–133 in type species and S. cerevisiae cagtctcttaaggagataat; one mismatch allowed). Forms a monophyletic, least inclusive clade in Edaphochytriaceae, covering sequences EUK 1200051, EUK 1630709, EUK 1200763, and EUK 1123748 (Figs 1, 8).

Notes.

Recognized based on eDNA sequences only. Comprises potentially 4–5 species represented by sequences EUK 1200051 (forest soil in Estonia), EUK 1630709 (forest soil in Estonia), and EUK 0133658 (plantation soil in the Canary Islands).