Palomastix lacustris Tedersoo sp. nov.

Diagnosis.

Separation from other species of Palomastix based on ITS 2 (positions 225–244 ctaaaagtcgggtttgattt; one mismatch allowed) and ITS 1 (positions 464–483 cagcaggtcttgactgactt; one mismatch allowed) as indicated in Fig. 24. Intraspecific variation up to 1.4 % in ITS 2. Interspecific distance at least 9.2 % in ITS 2.

Type.

Vouchered sediment sample TUE 030088 (holotype); eDNA sequence EUK 1123686 = OZ 253797 (legitype); eDNA sample TUE 130088 (nucleotype); FunAqua lake sediment sample W 0021 s; Palojärv, Estonia, 58.0830°N, 26.9143°E .

Description.

Other sequences: EUK 0320710 and EUK 0574068 (type locality); EUK 0320711, EUK 0320713 (FunAqua lake sediment sample in Viitna Pikkjärv, Estonia, 59.4469°N, 26.0107°E); and EUK 0320712 (FunAqua lake sediment sample W 0992 s in Svartkulpen, Norway, 59.9741°N, 10.7373°E).

Etymology.

> Palo (Estonian) refers to the type locality, Lake Palojärv; lacustris refers to habitat in lakes.

Notes.

Found in sediment samples in Northern Europe (n = 3). There are no records in GlobalFungi.