Chthonolpidiomycetes Tedersoo class. nov.

Type order.

Chthonolpidiales Tedersoo .

Diagnosis.

Distinguishable from other fungi based on diagnostic nucleotide signature in LSU D 2 (positions 695–714 in type species and 604–623 in S. cerevisiae gactgcttgcaggctgcata; three mismatches allowed). Forms a monophyletic, least inclusive clade in Olpidiomycota, covering sequences EUK 1124876, EUK 0534818, EUK 0534797, EUK 1191212, and EUK 1138033 (Fig. 1).

Notes.

Recognized based on eDNA sequences only. Encoded as clade GS 93 K in EUKARYOME v 1.9. Currently harbors Chthonolpidiales (ord. nov.). Comprises potentially 25–30 species. Detected in soil (95.9 % out of the 73 records) and mosses (4.1 %) in tundra to hot tropical biomes across all continents except Antarctica.