Aquieurochytrium lacustre Tedersoo & Esmaeilzadeh-Salestani sp. nov.

Diagnosis.

Separation from other species of Aquieurochytrium based on the ITS 2 (positions 297–316 gaaaggggatctgttttttt; one mismatch allowed) and LSU D 2 (positions 470–489 in type species and 450–469 in S. cerevisiae atgtcgagtccccgatcagt; no mismatch allowed) as indicated in Fig. 7. Intraspecific variation up to 1.1 % in ITS 2. Interspecific distance at least 3.4 % in ITS 2.

Type.

Vouchered aquatic eDNA sample TUE 128819 (holotype); eDNA sequence EUK 1102113 = OZ 253788 (legitype); freshwater in Lake Skogaryd, Sweden, 58.37°N, 12.16°E .

Description.

Other sequences: EUK 0584914 (FunAqua sample W 0790 w; lake water in Beukenlaan, Netherlands, 52.000°N, 4.487°E); EUK 0584915 (FunAqua sample W 0038 w; water in Lake Luke Vanajärv, Estonia, 58.2438°N, 26.5751°E); EUK 0584916 (FunAqua sample W 0458 w; water in Lake Stübnitzsee, Germany, 53.1071°N, 13.1891°E); EUK 0584917 (FunAqua sample W 0624 w; water in Lake Vejlsø, Denmark, 56.1514°N, 9.5618°E); EUK 0584918 (FunAqua sample W 0454 w; water in Lake Kleiner Wentowsee, Germany, 53.4494°N, 13.1052°E); and EUK 0584919 (FunAqua sample W 0364 s; sediment in Lake Ototoa, New Zealand, –36.5302, 174.2324).

Etymology.

Aqua (Latin) and Europa (Greek) refer to the habitat in European waters; and lacuster (Latin) specifies the lake habitat.

Notes.

Found in six temperate and boreal freshwater lakes in Central and Northern Europe, with one record from New Zealand (sequences differ by one nucleotide from closest European records; sequenced in an independent library). The eight additional GlobalFungi records originate from lake water in Scandinavia.