Aquieurochytriales Tedersoo & Esmaeilzadeh-Salestani ord. nov.

Type family.

Aquieurochytriaceae Tedersoo & Esmaeilzadeh-Salestani .

Diagnosis.

Distinguishable from other fungi based on diagnostic nucleotide signatures in LSU D 1 (positions 171–185 in type species and S. cerevisiae ggcaagccgggcaaa; one mismatch allowed), SSU V 4 (positions 871–885 in S. cerevisiae atactttcattagtc; one mismatch allowed), and ITS 2 (positions 173–195 in type species taatgctgggcgtcagcctgctt OR taatgacgggcgtcagcctgctt; three mismatches allowed). Forms a monophyletic, least inclusive clade in Aquieurochytriomycetes, covering sequences AB 971081, EUK 1100022, EUK 1102113, EUK 1123700, and EUK 1102276 (Fig. 1).

Notes.

Recognized based on eDNA sequences only. Currently includes Aquieurochytriaceae (fam. nov.).