Dobrisimastix Tedersoo gen. nov.
Type species.
Dobrisimastix vlkii Tedersoo .
Diagnosis.
Distinguishable from other fungi based on diagnostic nucleotide signatures in ITS 2 (positions 2–18 in type species taaaatrtcacaaccac; one mismatch allowed), SSU V 4 (positions 700–719 in S. cerevisiae ctggtgaatcatcgtgctct; no mismatch allowed), LSU D 1 (positions 124–138 in the type species and 122–136 in S. cerevisiae tgggtaggttacctg; one mismatch allowed), and LSU D 2 (positions 507–526 in type species and 452–471 in S. cerevisiae tgtataagaggcttcgcttg; one mismatch allowed). Forms a monophyletic, least inclusive clade in Dobrisimastigaceae, covering sequences EUK 1189296, EUK 1138904, EUK 0534669, EUK 0534670, and EUK 0534680 (Figs 1, 21).
Notes.
Recognized based on eDNA sequences only. Harbors 10–12 potential species represented by sequences EUK 1138904 (forest soil in New Zealand), EUK 0534669 (forest soil in Guatemala), EUK 0534670 (forest soil in Colombia), EUK 0534680 (forest soil in Colombia), EUK 0534676 (greenhouse soil in Estonia), EUK 0534677 (forest soil in Mexico), and EUK 0534667 (forest soil in Tanzania).