Savannolpidium raadiense Tedersoo & Esmaeilzadeh-Salestani sp. nov.

Diagnosis.

Separation from other species of Savannolpidium based on ITS 2 (positions 16–40 agatctcatcttctttagagttggc; no mismatch allowed) and LSU (positions 468–492 tataaagggaggctagtgtgagcgc; no mismatch allowed) as indicated in Fig. 42. Intraspecific variation up to 1.6 % in ITS 2 and 0.9 % in LSU. Interspecific distance at least 2.8 % in ITS 2.

Type.

Vouchered soil sample TUE 002210 (holotype); eDNA sequence EUK 1124874 = OZ 253807 (legitype); eDNA sample TUE 102210 (nucleotype); GSMc plot G 5233, Populus balsamifera - dominated wasteland soil in Raadi, Estonia, 58.3972°N, 26.7693°E .

Description.

Other sequences: EUK 1138191 (type locality); EUK 1217298 (GSMc plot G 4777, flooded grassland soil Suur-Pakri Härs-hämani, Estonia, 59.3310°N, 23.9272°E); EUK 0332294 (GSMc plot G 5899, dry Juniperus shrubland soil in Virtsu, Estonia, 58.5775°N, 23.5547°E); EUK 0332296 (flooded grassland soil in Haanja, Estonia, 57.7165°N, 27.0549°E); EUK 0534754 (GSMc plot G 6107, Quercus woodland soil in Armishte, Iraqi Kurdistan, 37.0468°N, 42.8049°E); EUK 0584862 (FunAqua river sediment sample W 1356 s, Spey, Scotland, 57.0552, – 4.1276°E); EUK 0584863 (FunAqua saltwater sediment sample W 0938 s, Laguna di Orbetello, Italy, 42.4296°N, 11.1988°E).

Etymology.

Savanna (Taino) refers to treeless grasslands, and Raadi (Estonian) refers to the type locality.

Notes.

Found in grassy and disturbed habitats and aquatic sediments in Europe and the Middle East (n = 25 records). This is supported by 18 additional GlobalFungi records from agricultural and grassland soils in Europe.