Algovorax scenedesmi (Fott) Tedersoo & Y. Ding comb. nov.

Basionym.

Phlyctidium scenedesmi Fott [480416].

Synonym.

Rhizophydium scenedesmi (Fott) Karling [480758].

Diagnosis.

Separation from species of Phlyctidium and Rhizophydium based on the lack of rhizoids, large sporangium (5–8 µm), and thin-walled zoospores. Distinguishable from other fungi based on a diagnostic nucleotide signature in ITS 2 (positions 79–98 tgttttgcataaaaacagga; one mismatch allowed) as indicated in Fig. 15. Intraspecific variation up to 1.7 % in ITS 2. Interspecific distance at least 6.7 % in ITS 2.

Type.

Species description based on illustrations in Fott (1967: 100) (holotype); parasitized algal sample CCTCC M 2015486 (epitype), eDNA sequences MF 163176 (SSU) and EUK 0509847 = OZ 253793 (ITS) obtained from the epitype; culture EPG 01, freshwater pond algae in Chenghai, Yunnan, China (26.38°N, 100.41°E) .

Description.

As in Fott (1967). Other sequence: EUK 0319835 (FunAqua sediment sample W 0265; Malinówka river in Krzesławicka, Poland, 49.9864°N, 20.0136°E).

Etymology.

Algovorax is derived from the Latin words algos (algae) and vorare (to devour), referring to algae eaters following the parasitic habit characteristic of the type species.

Notes.

An old species resurrected by identified specimens and DNA sequences. The eDNA sequence EUK 0319835 from Poland provides an additional link between the holotype description from Czechia and the epitype from China. There are no additional records in GlobalFungi. Algal hosts besides Scenedesmus spp. include Chlorococcum spp. and Graesiella sp. (Ding et al. 2018).