Viljandia globalis Tedersoo sp. nov.

Diagnosis.

Separation from other species of Viljandia based on ITS 2 (positions 73–92 ggattgcatggactgccgtc; one mismatch allowed) and LSU (positions 594–613 gcaaagctaccgtgtccaga; one mismatch allowed) as indicated in Fig. 58. Intraspecific variation up to 7.5 % in ITS 2 and up to 2.2 % in LSU. Interspecific distance> 20 % in ITS 2.

Type.

Vouchered soil sample TUE 028497 (holotype); eDNA sequence EUK 1124341 = OZ 253815 (legitype); eDNA sample TUE 128497 (nucleotype); GSMc plot G 5902, irrigated stadium lawn in Viljandi, Estonia, 58.3611°N, 25.6068°E .

Description.

Other sequences: EUK 1632579 (GSMc plot G 4506, woodland soil in Terikeste Hiiepärna, Estonia, 58.2972°N, 27.0681°E); LC 204214 ( Picea crassifolia temperate forest soil in Inner Mongolia, China, 38.77°N, 105.89°E); EUK 1124345 (GSMc plot G 5901, Aesculus hippocastanum alley soil in Tartu, Estonia, 58.3676°N, 26.7255°E); EUK 1105441 (boreal coniferous forest soil near Hofors, Sweden, 60.49°N, 16.3°E); EUK 1216896 (GSMc plot G 4796, Acer platanoides forest soil in Alavere, Estonia, 58.7562°N, 26.5109°E); KF 296788 (tundra soil in Prince Patrick Island, Canada, 76.23, – 119.3); and MK 536720 (soil crust in Victoria Land, Antarctica).

Etymology.

Viljandi (Estonian) refers to the type locality, and globus (Latin) refers to the globe, reflecting the cosmopolitan distribution.

Notes.

Distributed in soil worldwide, including Antarctica (n = 39 records). The 119 additional GlobalFungi records support these findings.