Dobrisimastigaceae Tedersoo fam. nov.
Type genus.
Dobrisimastix Tedersoo .
Diagnosis.
Distinguishable from other fungi based on diagnostic nucleotide signatures in the ITS 2 region (positions 2–18 in type species taaaatrtcacaaccac; three mismatches allowed), SSU V 4 (positions 700–719 in S. cerevisiae ctggtgaatcatcgtgctct; one mismatch allowed), and LSU D 1 (positions 124–138 in the type species and 122–136 in S. cerevisiae tgggtaggttacctg; two mismatches allowed). Forms a monophyletic, least inclusive clade in Dobrisimastigales, covering sequences EUK 1189296, EUK 1138904, EUK 0534669, EUK 0534670, and EUK 0534680 (Fig. 1).
Notes.
Recognized based on eDNA sequences only. Comprises Dobrisimastix (gen. nov.).