Curlevskia holarctica Tedersoo sp. nov.
Diagnosis.
Separation from other species of Curlevskia based on ITS 2 (positions 187–206 acgcttytgtgacttcctcc; two mismatches allowed) and LSU D 2 (positions 493–512 caatgttcagcgcccctcgt; no mismatch allowed) as indicated in Fig. 30. Intraspecific variation up to 2.1 % in ITS 2 and 1.3 % in LSU. Interspecific distance at least 4.4 % in ITS 2 and 2.8 % in LSU.
Type.
Vouchered soil sample TUE 002212 (holotype); eDNA sequence EUK 1124409 = OZ 253801 (legitype); eDNA sample TUE 102212 (nucleotype); GSMc plot G 5235, Larix sp. plantation in Rõõmu, Estonia, 58.3835°N, 26.7742°E .
Description.
Other sequences: EUK 1630897 (GSMc plot G 4803, Ulmus-Alnus forest soil in Meegaste, Estonia, 58.0563°N, 26.3355°E); EUK 1603984 (GSMc plot G 5821, gravel quarry soil in Siimusti, Estonia, 58.7306°N, 26.3198°E); EUK 1602442 (GSMc plot G 4128, Quercus robur woodland soil in Ööriku, Estonia, 58.5831°N, 22.9322°E); and EUK 1700061 (GSMc plot IH. ME 05, Abies forest soil in Mestia, Georgia, 43.0209°N, 42.7325°E).
Etymology.
Curlevski refers to Nathalie J. A. Curlevski, who was the first to collect material of this genus (GU 187865; Curlevski et al. 2014), and holarctica refers to its distribution.
Notes.
Found in soil in four contrasting sites in Estonia and once in Georgia. The 11 additional records in GlobalFungi point to a broader distribution in Eurasian and North American soils.