Anacharis eucharioides (Dalman, 1818)

Figs 2 G, 3 F, 10 A – E

Cynips eucharioides Dalman, 1818: 78 - type lost.

Anacharis tinctus Walker, 1835: 520 - lectotype (NHMUK) ♀, synonymised in Fergusson (1968), photographs examined.

Megapelmus spheciformis Hartig, 1840: 202 (removed from synonymy with A. typica) - lectotype (ZSM) ♂, first synonymised in Reinhard (1860), examined.

Anacharis fergussoni Mata-Casanova & Pujade-Villar, 2018: 16 syn. nov. - holotype (CNC) ♀, photographs examined.

Anacharis eucharoides auct., common misspelling.

Diagnosis

(n = 290). Most common species within the eucharioides species group. Medium sized body (2.7–3.4, mean 3.1 mm, similar to A. typica, A. petiolata & A. martinae). Differing from A. typica and A. petiolata by having a mesoscutellum with a median carina present, which is typically interrupted centrally by reticulation (largely smooth and even in A. petiolata and A. typica) (Fig. 10 D). Differing from A. martinae by having the lateromedial area of the pronotum smooth to rugose (Fig. 10 B, with longitudinal carinae that are a continuation of the ventral carinae in A. martinae). Unique in usually having the mesoscutum glabrous to more sparsely pubescent than the rest of the mesoscutum (Fig. 10 D, more evenly pubescent in all other species). The male genitalia of A. eucharioides (Fig. 3 F) are unique in not being significantly widened basally or medially, i. e. being more parallel-sided (basally or medially widened in all other species Fig. 3 C – E).

CO 1 barcode.

n = 289. Maximum intraspecific distance = 2.5 %. Minimum distance to closest species ( A. petiolata) = 2.9 %. CO 1 barcode consensus sequence:

AATTTTATACTTTATTTTAGGTATTTGATCTGGAATAATAGGATCAAGATTAAGAATAATTATTCGAAT AGAATTAGGAACCCCATCTCAATTAATCATAAATGATCAAATTTATAATTCAATTGTAACTGCTCATGCA TTTATTATAATTTTCTTTATAGTTATACCTATTATAGTTGGAGGATTTGGGAATTATTTAGTACCTTTAA TATTAATTTCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGATTTTTAATCCCTTCCTT ATTTTTAATAACAATTAATTTATTTATTGATCAAGGAGCAGGAACAGGATGAACTGTTTACCCTCCATTA TCCTCCCTAACAGGTCATCCATCTATATCAGTAGATTTAGTTATTTACTCATTACATTTAAGTGGAATTT CATCAATTCTTGGATCAATTAATTTTATTGTAACCATTTTAAATATACGAATAACTTCTATATCTATAGA CAAAATTTCATTATTTATTTGATCTATTTTTCTAACTACAATTTTACTATTATTATCTTTACCCGTACTA GCAGGAGGATTAACGATACTATTATTTGATCGAAATTTAAATACATCTTTTTTTGACCCCACAGGAGGAG GAGACCCTATTCTTTATCAACATTTATTT

Type material.

Lectotype of Anacharis tinctus Walker, 1835, designated by Fergusson (1986)

81 86 [on backside of mounting board]

Type

B. M. 1981. Under tincta

LECTO-TYPE

LECTOTYPE Anacharis tincta Walker det. N. D. M. Fergusson, 1981

B. M. TYPE HYM 7.162

[QR code] NHMUK 012858912

[for images, see https://data.nhm.ac.uk/dataset/56e711e6-c847-4f99-915a-6894bb5c5dea/resource/05ff2255-c38a-40c9-b657-4ccb55ab2feb/record/10470209]

Lectotype of Megapelmus spheciformis Hartig, 1840, designated by Weld (1952)

Weld 1931

Megapelmus spheciformis [handwritten, probably by Hartig himself]

LECTOTYPE of MEGAPELMUS spheciformis det. N. D. M. Fergusson, 1982

Anacharis eucharoides Dal. det. N. D. M. Fergusson, 1982

Anacharis eucharioides (Dalman, 1818) ♂ Det. Jonathan Vogel 2024

Holotype of Anacharis fergussoni Mata-Casanova & Pujade-Villar, 2018

Germany • 1 ♀; Rhineland Palatinate, Mainz-Bingen, Ingelheim am Rhein, orchard; 1–30 Sep. 1968; I. Sreffan leg.; Malaise trap .

[for images, see https://www.cnc.agr.gc.ca/taxonomy/Specimen.php?id=3274133]

Other material examined.

DNA barcode voucher s. Belgium • 1 ♀; East Flanders, Assenede, Isabellepolder, Agricultural land with Partridge mix; 51.266 ° N, 3.71 ° E; ca 0 m a. s. l.; 12–19 Jun. 2019; UGent leg.; yellow pan trap; ZFMK -TIS-2640673 . • 2 ♂♂; West Flanders, Ypres, De Triangel, Urban park (bushes); 50.8418 ° N, 2.8838 ° E; ca 20 m a. s. l.; 30 Apr. - 14 May 2022; Verheyde, Fons leg.; Malaise trap; ZFMK -TIS-2640843, ZFMK -TIS-2640844 . • 3 ♀♀, 9 ♂♂; same collection data as for preceding 14–28 May 2022; females - ZFMK -TIS-2640845, ZFMK -TIS-2640846, ZFMK -TIS-2640847, ZFMK -TIS-2640859, ZFMK -TIS-2640860, ZFMK -TIS-2640861; males - ZFMK -TIS-2640848, ZFMK -TIS-2640849, ZFMK -TIS-2640850, ZFMK -TIS-2640851, ZFMK -TIS-2640852, ZFMK -TIS-2640853, ZFMK -TIS-2640854, ZFMK -TIS-2640855, ZFMK -TIS-2640856, ZFMK -TIS-2640862, ZFMK -TIS-2640863 . • 1 ♂; same collection data as for preceding 2–23 Jul. 2022; ZFMK -TIS-2640868 . • 3 ♀♀, 2 ♂♂; West Flanders, Ypres, De Triangel, Urban park (pool vegetation); 50.8427 ° N, 2.884 ° E; ca 20 m a. s. l.; 14–28 May 2022; Verheyde, Fons leg.; Malaise trap; females - ZFMK -TIS-2640859, ZFMK -TIS-2640860, ZFMK -TIS-2640861; males - ZFMK -TIS-2640862, ZFMK -TIS-2640863 .

Germany • 1 ♂; Baden-Württemberg, Biberach, Altheim; 48.1399 ° N, 9.4491 ° E; ca 540 m a. s. l.; 6–19 Aug. 2013; Schmalfuß, H. leg.; Malaise trap; ZFMK -TIS-2629512 . • 2 ♀♀, 8 ♂♂; Baden-Württemberg, Karlsruhe, Malsch, Hansjakobstraße, garden; 48.8835 ° N, 8.3197 ° E; ca 120 m a. s. l.; 26 Apr. - 10 May 2020; Dieter Doczkal leg.; Malaise trap; females - ZFMK -TIS-2640753, ZFMK -TIS-2640754; males - ZFMK -TIS-2640745, ZFMK -TIS-2640746, ZFMK -TIS-2640747, ZFMK -TIS-2640748, ZFMK -TIS-2640749, ZFMK -TIS-2640750, ZFMK -TIS-2640751, ZFMK -TIS-2640752 . • 1 ♂; same collection data as for preceding 25 Oct. - 8 Nov. 2020; ZFMK -TIS-2640726 . • 11 ♀♀, 1 ♂; Baden-Württemberg, Stuttgart, Espan; 49.6167 ° N, 9.2667 ° E; ca 280 m a. s. l.; 28 Jul. - 28 Aug. 2014; Woog, F. leg.; females - ZFMK -TIS-2640775, ZFMK -TIS-2640776, ZFMK -TIS-2640777, ZFMK -TIS-2640778, ZFMK -TIS-2640779, ZFMK -TIS-2640780, ZFMK -TIS-2640781, ZFMK -TIS-2640782, ZFMK -TIS-2640783, ZFMK -TIS-2640784, ZFMK -TIS-2640785; male - ZFMK -TIS-2640786 . • 1 ♀, 10 ♂♂; Baden-Württemberg, Tübingen, Hirschau, Oberes Tal, orchard; 48.505 ° N, 8.993 ° E; ca 390 m a. s. l.; 29 Apr. - 13 May 2014; Kothe, T., Engelhardt, M., Bartsch, D. leg.; Malaise trap; female - ZFMK -TIS-2629263; males - ZFMK -TIS-2629200, ZFMK -TIS-2629201, ZFMK -TIS-2629202, ZFMK -TIS-2629203, ZFMK -TIS-2629204, ZFMK -TIS-2629218, ZFMK -TIS-2629540, ZFMK -TIS-2629541, ZFMK -TIS-2629542, ZFMK -TIS-2640774 . • 1 ♂; Baden-Württemberg, Tübingen, Hirschau, Oberes Tal, orchard; 48.505 ° N, 8.9935 ° E; ca 370 m a. s. l.; 23 May- 6 Jun. 2014; Kothe, T., Engelhardt, M., Bartsch, D. leg.; Malaise trap; ZFMK -TIS-2628235 . • 3 ♀♀; Baden-Württemberg, Tübingen, Hirschau, Wiesenweingärten; 48.5043 ° N, 8.9956 ° E; ca 380 m a. s. l.; 17–31 Jul. 2014; Kothe, T., Engeldhardt, M., König, C. leg.; Malaise trap; ZFMK -TIS-2629238, ZFMK -TIS-2629267, ZFMK -TIS-2629268 . • 1 ♀; Baden-Württemberg, Tübingen, Steinenberg; 48.5306 ° N, 9.0312 ° E; ca 470 m a. s. l.; 31 Jul. - 14 Aug. 2014; Kothe, T., Engeldhardt, M., König, C. leg.; Malaise trap; ZFMK -TIS-2629237 . • 4 ♀♀; Baden-Württemberg, Tübingen, Steinenberg; 48.5313 ° N, 9.03 ° E; ca 490 m a. s. l.; 4–17 Jul. 2014; Kothe, T., Engelhardt, M., König, Ch. leg.; ZFMK -TIS-2629504, ZFMK -TIS-2629505, ZFMK -TIS-2629506, ZFMK -TIS-2629507 . • 1 ♀, 1 ♂; Baden-Württemberg, Tübingen, Steinenbergturm; 48.531 ° N, 9.03 ° E; ca 490 m a. s. l.; 14–29 Aug. 2014; Kothe, T., Engeldhardt, M., König, C. leg.; Malaise trap; female - ZFMK -TIS-2629236; male - ZFMK -TIS-2629219 . • 1 ♂; Baden-Württemberg, Tübingen, Wurmlingen, Gengental, orchard; 48.5131 ° N, 8.9923 ° E; ca 370 m a. s. l.; 13–23 May 2014; Kothe, T., Engeldhardt, M., König, C. leg.; Malaise trap; ZFMK -TIS-2640681 . • 1 ♀, 1 ♂; Bavaria, Main-Spessart, Lohr, Nat. res. Romberg, pasture woodland; 49.9864 ° N, 9.5896 ° E; ca 190 m a. s. l.; 9 Jun. - 6 Jul. 2018; Dieter Doczkal leg.; Malaise trap; female - ZFMK -TIS-2640717; male - ZFMK -TIS-2640716 . • 1 ♂; Bavaria, Rhön-Grabfeld, Fladungen, Nat. res. Schwarzes Moor, Karpatenbirkenwald; 50.5117 ° N, 10.071 ° E; ca 780 m a. s. l.; 26 Jun. - 18 Jul. 2017; Dieter Doczkal leg.; Malaise trap; ZFMK -TIS-2629538 . • 2 ♀♀; Hesse, Gießen, Nat. res. Holzwäldchen bei Gleiberg; 50.605 ° N, 8.6316 ° E; ca 190 m a. s. l.; 14 Jun. 2021; GBOL III leg.; sweep net; ZFMK -TIS-2629494, ZFMK -TIS-2629495 . • 1 ♀; Hesse, Kassel, Nat. res., „ Fuldaschleuse Wolfsanger “, meadow along Fulda river with Salix and Phragmites; 51.329 ° N, 9.5565 ° E; ca 130 m a. s. l.; 13–27 Oct. 2020; GBOL III leg.; sweep net; Loc. 1; ZFMK -TIS-2628230 . • 3 ♀♀; Hesse, Rheingau-Taunus, Lorch am Rhein, above Nollig castle; 50.0491 ° N, 7.7978 ° E; ca 240 m a. s. l.; 27 May- 7 Jun. 2013; Niehuis, Oliver leg.; Malaise trap; MF 1; ZFMK -TIS-2629498, ZFMK -TIS-2629499, ZFMK -TIS-2629500 . • 1 ♀, 1 ♂; same collection data as for preceding 17–25 Jun. 2015; MF 4; female - ZFMK -TIS-2629248; male - ZFMK -TIS-2629214 . • 8 ♂♂; same collection data as for preceding 15–21 Jul. 2013; MF 1; ZFMK -TIS-2629227, ZFMK -TIS-2629240, ZFMK -TIS-2629241, ZFMK -TIS-2629521, ZFMK -TIS-2629522, ZFMK -TIS-2629523, ZFMK -TIS-2629524, ZFMK -TIS-2629525 . • 20 ♂♂; same collection data as for preceding 21–27 Jul. 2013; ZFMK -TIS-2629225, ZFMK -TIS-2629226, ZFMK -TIS-2629553, ZFMK -TIS-2629554, ZFMK -TIS-2629555, ZFMK -TIS-2629556, ZFMK -TIS-2629557, ZFMK -TIS-2629558, ZFMK -TIS-2629559, ZFMK -TIS-2629560, ZFMK -TIS-2629576, ZFMK -TIS-2629577, ZFMK -TIS-2640820, ZFMK -TIS-2640821, ZFMK -TIS-2640822, ZFMK -TIS-2640823, ZFMK -TIS-2640824, ZFMK -TIS-2640825, ZFMK -TIS-2640826, ZFMK -TIS-2640827 . • 1 ♀; Hesse, Rheingau-Taunus, Lorch am Rhein, above Nollig castle; 50.0495 ° N, 7.7966 ° E; ca 250 m a. s. l.; 12–17 Jun. 2015; Niehuis, Oliver leg.; Malaise trap; MF 3; ZFMK -TIS-2629252 . • 3 ♂♂; same collection data as for preceding 17–25 Jun. 2015; ZFMK -TIS-2628232, ZFMK -TIS-2629212, ZFMK -TIS-2629213 . • 1 ♀; Hesse, Rheingau-Taunus, Lorch am Rhein, above Nollig castle; 50.0498 ° N, 7.7974 ° E; ca 260 m a. s. l.; 27 May- 7 Jun. 2013; Niehuis, Oliver leg.; Malaise trap; MF 2; ZFMK -TIS-2629266 . • 2 ♀♀; same collection data as for preceding 7–15 Jun. 2013; ZFMK -TIS-2628233, ZFMK -TIS-2629250 . • 5 ♀♀; same collection data as for preceding 15–23 Jun. 2013; ZFMK -TIS-2629269, ZFMK -TIS-2629270, ZFMK -TIS-2629271, ZFMK -TIS-2629501, ZFMK -TIS-2629502 . • 7 ♂♂; same collection data as for preceding 15–21 Jul. 2013; ZFMK -TIS-2629513, ZFMK -TIS-2629515, ZFMK -TIS-2629550, ZFMK -TIS-2629551, ZFMK -TIS-2629552, ZFMK -TIS-2640710, ZFMK -TIS-2640711 . • 12 ♂♂; same collection data as for preceding 21–27 Jul. 2013; ZFMK -TIS-2629243, ZFMK -TIS-2629244, ZFMK -TIS-2629245, ZFMK -TIS-2629246, ZFMK -TIS-2629496, ZFMK -TIS-2629497, ZFMK -TIS-2629527, ZFMK -TIS-2629528, ZFMK -TIS-2629529, ZFMK -TIS-2629530, ZFMK -TIS-2629531, ZFMK -TIS-2629532 . • 1 ♀, 1 ♂; Hesse, Waldeck-Frankenberg, National park Kellerwald-Edersee, Banfehaus, old floodplain of the Banfe; 51.167 ° N, 8.9749 ° E; ca 270 m a. s. l.; 22 Jul. - 5 Aug. 2021; GBOL III leg.; Malaise trap (Krefeld version); female - ZFMK -TIS-2640790; male - ZFMK -TIS-2640792 . • 2 ♀♀; Hesse, Waldeck-Frankenberg, National park Kellerwald-Edersee, Maierwiesen; 51.1555 ° N, 9.0015 ° E; ca 370 m a. s. l.; 22 Jun. - 8 Jul. 2021; GBOL III leg.; Malaise trap (Krefeld version); ZFMK -TIS-2640807, ZFMK -TIS-2640808 . • 9 ♀♀, 1 ♂; Hesse, Waldeck-Frankenberg, NP Kellerwald-Edersee, „ Banfe-Haus “; 51.167 ° N, 8.9749 ° E; ca 270 m a. s. l.; 7–21 Jul. 2022; GBOL III leg.; Malaise trap; females - ZFMK -TIS-2640761, ZFMK -TIS-2640762, ZFMK -TIS-2640763, ZFMK -TIS-2640764, ZFMK -TIS-2640765, ZFMK -TIS-2640766, ZFMK -TIS-2640767, ZFMK -TIS-2640768, ZFMK -TIS-2640769; male - ZFMK -TIS-2640755 . • 1 ♀; Hesse, Waldeck-Frankenberg, NP Kellerwald-Edersee, „ Kleiner Mehlberg “; 51.2105 ° N, 9.042 ° E; ca 360 m a. s. l.; 30 Sep. - 14 Oct. 2021; GBOL III leg.; Malaise trap; ZFMK -TIS-2640610 . • 1 ♂; Hesse, Waldeck-Frankenberg, NP Kellerwald-Edersee, „ Maierwiesen “; 51.1555 ° N, 9.0015 ° E; ca 370 m a. s. l.; 8–22 Jul. 2021; GBOL III leg.; Malaise trap; ZFMK -TIS-2640732 . • 1 ♀; Lower Saxony, Lüchow-Dannenberg, Pevestorf, Deichvorland & Deich; 53.0636 ° N, 11.4742 ° E; ca 20 m a. s. l.; 6–10 Aug. 2013; Krogmann, Lars leg.; Malaise trap; ZFMK -TIS-2629251 . • 1 ♀, 3 ♂♂; North Rhine-Westphalia, Bonn, Garden of Museum Koenig, Various habitats; 50.7215 ° N, 7.1137 ° E; ca 70 m a. s. l.; 4 Jul. 2022; Schwingeler, Josefine, Jonathan Vogel leg.; sweep net; female - ZFMK -TIS-2640738; males - ZFMK -TIS-2640735, ZFMK -TIS-2640736, ZFMK -TIS-2640737 . • 2 ♀♀; North Rhine-Westphalia, Bonn, Museum Koenig, garden; 50.7214 ° N, 7.1139 ° E; ca 70 m a. s. l.; 4 Oct. 2022; Salden, Tobias leg.; sweep net; ZFMK -TIS-2635303, ZFMK -TIS-2635304 . • 1 ♀; North Rhine-Westphalia, Borken, Borken, spinach field with flower strip; 51.8078 ° N, 6.8324 ° E; ca 60 m a. s. l.; 2–9 Aug. 2016; Schwarz et al. leg.; Malaise trap; ZFMK -TIS-2629284 . • 1 ♂; North Rhine-Westphalia, Delbrück, Delbrück, Nat. res. „ Steinhorster Becken “; 51.8217 ° N, 8.542 ° E; ca 90 m a. s. l.; 22 Jul. - 5 Aug. 2021; GBOL III leg.; Malaise trap; ZFMK -TIS-2640677 . • 1 ♀; North Rhine-Westphalia, Paderborn, Delbrück, Nat. res. „ Erdgarten-Lauerwiesen “, alder carr surrounded by wet meadows, ponds, muddy, geese; 51.7989 ° N, 8.6582 ° E; ca 110 m a. s. l.; 31 Aug. - 14 Sep. 2021; GBOL III leg.; Malaise trap; ZFMK -TIS-2640674 . • 1 ♀; North Rhine-Westphalia, Paderborn, Delbrück, Nat. res. „ Steinhorster Becken “; 51.82 ° N, 8.5409 ° E; ca 90 m a. s. l.; 19 Aug. - 2 Sep. 2021; GBOL III leg.; Malaise trap; ZFMK -TIS-2640692 . • 1 ♀, 1 ♂; same collection data as for preceding 2–16 Sep. 2021; female - ZFMK -TIS-2640715; male - ZFMK -TIS-2640714 . • 1 ♀, 4 ♂♂; same collection data as for preceding 16–30 Sep. 2021; female - ZFMK -TIS-2640803; males - ZFMK -TIS-2640799, ZFMK -TIS-2640800, ZFMK -TIS-2640801, ZFMK -TIS-2640802 . • 9 ♂♂; same collection data as for preceding 30 Sep. - 14 Oct. 2021; ZFMK -TIS-2640810, ZFMK -TIS-2640811, ZFMK -TIS-2640812, ZFMK -TIS-2640813, ZFMK -TIS-2640814, ZFMK -TIS-2640815, ZFMK -TIS-2640816, ZFMK -TIS-2640817, ZFMK -TIS-2640818 . • 1 ♀; North Rhine-Westphalia, Paderborn, Delbrück, Nat. res. „ Steinhorster Becken “; 51.8252 ° N, 8.5359 ° E; ca 90 m a. s. l.; 19 Aug. - 2 Sep. 2021; GBOL III leg.; Malaise trap; ZFMK -TIS-2640693 . • 6 ♂♂; same collection data as for preceding 2–16 Sep. 2021; ZFMK -TIS-2640793, ZFMK -TIS-2640794, ZFMK -TIS-2640795, ZFMK -TIS-2640796, ZFMK -TIS-2640797, ZFMK -TIS-2640798 . • 4 ♂♂; same collection data as for preceding 16–30 Sep. 2021; ZFMK -TIS-2640727, ZFMK -TIS-2640728, ZFMK -TIS-2640729, ZFMK -TIS-2640730 . • 1 ♀; North Rhine-Westphalia, Rhein-Sieg-Kreis, Oberdrees, Buschfeld; 50.6371 ° N, 6.9157 ° E; ca 160 m a. s. l.; 28 May- 6 Jun. 2021; GBOL III leg.; Malaise trap; ZFMK -TIS-2640679 . • 1 ♀; North Rhine-Westphalia, Rhein-Sieg-Kreis, Schladern near Windeck, Sieg river, right river bank; 50.8 ° N, 7.585 ° E; ca 130 m a. s. l.; 30 May- 6 Jun. 2017; ZFMK et al. leg.; Malaise trap; ZFMK -TIS-2628234 . • 1 ♀; same collection data as for preceding 6–13 Jun. 2017; ZFMK -TIS-2629239 . • 1 ♀; same collection data as for preceding 13–20 Jun. 2017; ZFMK -TIS-2629262 . • 4 ♀♀; same collection data as for preceding 20–27 Jun. 2017; ZFMK -TIS-2629279, ZFMK -TIS-2629280, ZFMK -TIS-2629281, ZFMK -TIS-2629282 . • 2 ♀♀; same collection data as for preceding 27 Jun. - 4 Jul. 2017; ZFMK -TIS-2629260, ZFMK -TIS-2629261 . • 3 ♀♀; same collection data as for preceding 4–11 Jul. 2017; ZFMK -TIS-2629264, ZFMK -TIS-2629275, ZFMK -TIS-2629277 . • 10 ♀♀, 23 ♂♂; same collection data as for preceding 18–25 Jul. 2017; females - ZFMK -TIS-2629290, ZFMK -TIS-2629292, ZFMK -TIS-2629487, ZFMK -TIS-2629488, ZFMK -TIS-2629489, ZFMK -TIS-2629490, ZFMK -TIS-2629508, ZFMK -TIS-2629561, ZFMK -TIS-2629562, ZFMK -TIS-2629563; males - ZFMK -TIS-2629217, ZFMK -TIS-2629247, ZFMK -TIS-2629265, ZFMK -TIS-2629286, ZFMK -TIS-2629287, ZFMK -TIS-2629288, ZFMK -TIS-2629291, ZFMK -TIS-2629293, ZFMK -TIS-2629294, ZFMK -TIS-2629486, ZFMK -TIS-2629492, ZFMK -TIS-2629510, ZFMK -TIS-2629511, ZFMK -TIS-2629518, ZFMK -TIS-2629519, ZFMK -TIS-2629520, ZFMK -TIS-2629564, ZFMK -TIS-2629565, ZFMK -TIS-2629566, ZFMK -TIS-2629567, ZFMK -TIS-2629569, ZFMK -TIS-2629570, ZFMK -TIS-2629571 . • 7 ♀♀, 19 ♂♂; same collection data as for preceding 1–8 Aug. 2017; females - ZFMK -TIS-2629253, ZFMK -TIS-2629254, ZFMK -TIS-2629255, ZFMK -TIS-2629256, ZFMK -TIS-2629257, ZFMK -TIS-2629258, ZFMK -TIS-2629259; males - ZFMK -TIS-2629215, ZFMK -TIS-2629224, ZFMK -TIS-2629228, ZFMK -TIS-2629231, ZFMK -TIS-2629232, ZFMK -TIS-2629233, ZFMK -TIS-2629234, ZFMK -TIS-2629235, ZFMK -TIS-2629543, ZFMK -TIS-2629544, ZFMK -TIS-2629545, ZFMK -TIS-2629546, ZFMK -TIS-2629547, ZFMK -TIS-2629548, ZFMK -TIS-2629549, ZFMK -TIS-2629572, ZFMK -TIS-2629573, ZFMK -TIS-2629574, ZFMK -TIS-2629575 . • 2 ♂♂; same collection data as for preceding 15–30 Aug. 2017; ZFMK -TIS-2629220, ZFMK -TIS-2640675 . • 1 ♂; Rhineland-Palatinate, Ahrweiler, Niederzissen, Bausenberg; 50.4679 ° N, 7.2223 ° E; ca 330 m a. s. l.; 12–27 Jul. 2022; Jaume-Schinkel, Santiago leg.; Gressit Malaise trap; ZFMK -TIS-2640672 . • 1 ♀, 1 ♂; Rhineland-Palatinate, Ahrweiler, Niederzissen, Bausenberg, dry grassland; 50.4647 ° N, 7.2222 ° E; ca 320 m a. s. l.; 14–20 Jul. 2017; ZFMK et al. leg.; Malaise trap; MF 5; female - ZFMK -TIS-2629509; male - ZFMK -TIS-2629516 . • 1 ♀; Rhineland-Palatinate, Alzey-Worms, Wine fields north of Monsheim, shrub islands between wine fields, mostly poplars; 49.6406 ° N, 8.2137 ° E; ca 150 m a. s. l.; 5–24 Aug. 2021; Gilgenbach, Carolin leg.; Malaise trap; ZFMK -TIS-2640678 . • 1 ♂; Rhineland-Palatinate, Cochem, Nat. res. Brauselay; 50.1421 ° N, 7.1881 ° E; ca 120 m a. s. l.; 29 May 2020; DINA leg.; Malaise trap; ZFMK -TIS-2629216 (EVK) . • 1 ♀; Saarland, Neunkirchen, Schiffweiler, Landsweiler-Reden, Höfertal; 50.0767 ° N, 7.3283 ° E; ca 370 m a. s. l.; 18 Jun. 2022; AK Diptera leg.; sweep net; ZFMK -TIS-2640838 . • 1 ♂; Saarland, Saarpfalz, Gersheim; 49.31 ° N, 8.1683 ° E; ca 140 m a. s. l.; 19 Jun. 2022; AK Diptera leg.; sweep net; ZFMK -TIS-2640839 . • 2 ♂♂; Schleswig-Holstein, Nordfriesland, Nat. res. Luetjenholmer Heidedünen; 54.6963 ° N, 9.0643 ° E; ca 0 m a. s. l.; 29 May 2020; DINA leg.; Malaise trap; ZFMK -TIS-2629229 (EVK), ZFMK -TIS-2629230 (EVK) .

Lithuania • 1 ♀; Silute distr., Sysa, Sysa, control plot; 55.3127 ° N, 21.4049 ° E; ca 0 m a. s. l.; 15–25 Jul. 2020; Petrasiunas, Andrius leg.; Malaise trap; ZFMK -TIS-2637713 .

The Netherlands • 1 ♂; Noord-Holland, Amsterdam, Vondelpark; 52.3581 ° N, 4.8681 ° E; ca 0 m a. s. l.; 3–12 Jun. 2019; Taxon Expeditions Team leg.; Malaise trap; ZFMK -TIS-2640687 . • 2 ♀♀, 1 ♂; same collection data as for preceding 12–15 Jun. 2019; females - ZFMK -TIS-2640718, ZFMK -TIS-2640719; male - ZFMK -TIS-2640720 . • 1 ♂; same collection data as for preceding 21–25 Jun. 2019; ZFMK -TIS-2640689 . • 1 ♀; same collection data as for preceding 19–27 Jul. 2019 . • 2 ♀♀, 1 ♂; same collection data as for preceding 7 Aug. 2019; females - ZFMK -TIS-2640721, ZFMK -TIS-2640722; male - ZFMK -TIS-2640723 . • 2 ♂♂; Noord-Holland, Amsterdam, Vondelpark, Urban park; 52.356 ° N, 4.861 ° E; ca 0 m a. s. l.; 19–27 Jul. 2019; Taxon Expeditions (M. Schilthuizen) leg.; Malaise trap; ZFMK -TIS-2640841, ZFMK -TIS-2640842 . • 1 ♀; same collection data as for preceding 2019; ZFMK -TIS-2640840 .

Norway • 1 ♂; Rogaland Ytre, Finnøy, Nordre Vignes; 59.1679 ° N, 5.7883 ° E; ca 10 m a. s. l.; 22 Sep. - 1 Nov. 2020; Tengesdal, Gaute leg.; Malaise trap; ZFMK -TIS-2640680 .

Material without DNA barcode. Belgium • 1 ♂; Walloon Brabant, Ottignies; 3–10 Sep. 1983; Paul Dessart leg.; Malaise trap; JV_Prel_0057 (RBINS) . • 1 ♀, 1 ♂; Walloon Region, Luik, Wanze, Antheit (Corphalie); 50.5363 ° N, 5.2515 ° E; ca 110 m a. s. l.; 14–28 Jul. 1989; R. Detry leg.; Malaise trap; ZFMK -HYM-00039669, JV_Prel_0044 (RBINS) . • 1 ♂; same collection data as for preceding 28 Jul. - 11 Aug. 1989; JV_Prel_0054 (RBINS) . • 1 ♀, 1 ♂; West Flanders, Oostkamp, Private garden; 51.168 ° N, 3.276 ° E; ca 0 m a. s. l.; 16–30 Aug. 2020; Arnout Zwaenepoel leg.; Malaise trap; female - ZFMK -TIS-2640697; male - ZFMK -TIS-2640696 . • 1 ♂; West Flanders, Snellegem, Vloethembos; 9 Jun. 1983; P. Grootaert leg.; hand caught; JV_Prel_0059 (RBINS) . • 1 ♀; West Flanders, Ypres, De Triangel, Urban park (bushes); 50.8418 ° N, 2.8838 ° E; ca 20 m a. s. l.; 28 May- 18 Jun. 2022; Fons Verheyde leg.; Malaise trap; JV_Prel_0058 (RBINS) . • 1 ♀; same collection data as for preceding 20 Aug. - 3 Sep. 2022; JV_Prel_0053 (RBINS) . • 1 ♀; same collection data as for preceding 17 Sep. - 1 Oct. 2022; JV_Prel_0055 (RBINS) . • 15 ♀♀, 8 ♂♂; West Flanders, Ypres, De Triangel, Urban park (pool vegetation); 50.8427 ° N, 2.884 ° E; ca 20 m a. s. l.; 6–20 Aug. 2022; Fons Verheyde leg.; Malaise trap; females - JV_Prel_0111 (RBINS), JV_Prel_0112 (RBINS), JV_Prel_0113 (RBINS), JV_Prel_0114 (RBINS), JV_Prel_0115 (RBINS), JV_Prel_0116 (RBINS), JV_Prel_0117 (RBINS), JV_Prel_0118 (RBINS), JV_Prel_0119 (RBINS), JV_Prel_0120 (RBINS), JV_Prel_0121 (RBINS), JV_Prel_0122 (RBINS), JV_Prel_0123 (RBINS), JV_Prel_0124 (RBINS), JV_Prel_0125 (RBINS); males - JV_Prel_0103 (RBINS, JV_Prel_0104 (RBINS), JV_Prel_0105 (RBINS), JV_Prel_0106 (RBINS), JV_Prel_0107 (RBINS), JV_Prel_0108 (RBINS), JV_Prel_0109 (RBINS), JV_Prel_0110 (RBINS) . • 8 ♀♀, 10 ♂♂; same collection data as for preceding 20 Aug. - 3 Sep. 2022; females - JV_Prel_0095 (RBINS), JV_Prel_0096 (RBINS), JV_Prel_0097 (RBINS), JV_Prel_0098 (RBINS), JV_Prel_0099 (RBINS), JV_Prel_0100 (RBINS), JV_Prel_0101 (RBINS), JV_Prel_0102 (RBINS); males - JV_Prel_0085 (RBINS), JV_Prel_0086 (RBINS), JV_Prel_0087 (RBINS), JV_Prel_0088 (RBINS), JV_Prel_0089 (RBINS), JV_Prel_0090 (RBINS), JV_Prel_0091 (RBINS), JV_Prel_0092 (RBINS), JV_Prel_0093 (RBINS), JV_Prel_0094 (RBINS) . • 5 ♀♀, 9 ♂♂; same collection data as for preceding 3–17 Sep. 2022; females - JV_Prel_0068 (RBINS), JV_Prel_0069 (RBINS), JV_Prel_0070 (RBINS), JV_Prel_0071 (RBINS), JV_Prel_0072 (RBINS); males - JV_Prel_0061 (RBINS), JV_Prel_0062 (RBINS), JV_Prel_0063 (RBINS), JV_Prel_0064 (RBINS), JV_Prel_0065 (RBINS), JV_Prel_0066 (RBINS), JV_Prel_0067 (RBINS), ZFMK -HYM-00039673, ZFMK -HYM-00039672 .

Denmark • 4 ♂♂; Southern Jutland, Rømø; 24 Sep. 2000; Torkhild Munk leg.; NHRS - HEVA 000023146 (NHRS), NHRS - HEVA 000023147 (NHRS), NHRS - HEVA 000023148 (NHRS), NHRS - HEVA 000023149 (NHRS) . • 1 ♀; Western Jutland, Baldersbaek, plantation; 12 Jul. 1993; Torkhild Munk leg.; NHRS - HEVA 000023150 (NHRS) .

Germany • 1 ♀; Baden-Württemberg, Karlsruhe, Malsch, Luderbusch, south faced slope; 48.9131 ° N, 8.3325 ° E; ca 120 m a. s. l.; 26 Jul. - 2 Aug. 2020; Dieter Doczkal | K. Grabow leg.; Malaise trap; ZFMK -TIS-2640695 . • 1 ♂; Bavaria, Allgäu, Balderschwang, Leiterberg; 47.4858 ° N, 10.0899 ° E; ca 1290 m a. s. l.; 4–21 Sep. 2017; Dieter Doczkal | Johannes Voith leg.; Malaise trap; ZFMK -TIS-2640708 . • 1 ♀; Berlin, Berlin, Chausseestraße 109, ruderal area; 29 Jun. - 5 Jul. 2009; A. Wiesener | V. Richter | F. Koch leg.; MfN URI: 57384 a (ZHMB) . • 1 ♀; Hesse, Gießen, Botanical garden; 50.5859 ° N, 8.678 ° E; ca 170 m a. s. l.; 18 Jun. 2021; GBOL III leg.; sweep net; ZFMK -TIS-2629491 . • 1 ♂; Hesse, Rheingau-Taunus, Lorch am Rhein, oberhalb der Burg Nollig; 50.0491 ° N, 7.7978 ° E; ca 240 m a. s. l.; 21–27 Jul. 2013; Oliver Niehuis leg.; Malaise trap; ZFMK -TIS-2629579 . • 1 ♂; Hesse, Rheingau-Taunus, Lorch am Rhein, oberhalb der Burg Nollig; 50.0498 ° N, 7.7974 ° E; ca 260 m a. s. l.; 15–21 Jul. 2013; Oliver Niehuis leg.; Malaise trap; ZFMK -TIS-2629514 . • 2 ♂♂; same collection data as for preceding 21–27 Jul. 2013; ZFMK -TIS-2629242, ZFMK -TIS-2629526 . • 5 ♂♂; Hesse, Werra-Meißner-Kreis, Großalmerode, Private garden, Siedlerweg, semi-abandoned garden with wet spot, ivy hedge and salix; 51.2591 ° N, 9.7871 ° E; ca 380 m a. s. l.; 12–20 Jul. 2022; Jonathan Vogel leg.; Malaise trap; ZFMK -TIS-2640700, ZFMK -TIS-2640701, ZFMK -TIS-2640702, ZFMK -TIS-2640703, ZFMK -TIS-2640705 . • 2 ♀♀; North Rhine-Westphalia, Bonn, ZFMK garden, lawn and bushes; 50.7218 ° N, 7.1132 ° E; ca 70 m a. s. l.; 30 Aug. 2022; AG Hymenoptera leg.; sweep net; ZFMK -TIS-2640698, ZFMK -TIS-2640699 . • 1 ♀; same collection data as for preceding 1 Sep. 2022; ZFMK -HYM-00039670 . • 1 ♀; North Rhine-Westphalia, Rhein-Sieg-Kreis, Alfter, Mirbachstrasse; 50.7307 ° N, 7.0142 ° E; ca 90 m a. s. l.; 22 Jul. 2021; GBOL III leg.; sweep net; ZFMK -TIS-2629298 . • 1 ♀; North Rhine-Westphalia, Rhein-Sieg-Kreis, Schladern near Windeck, Sieg river, right river bank; 50.8 ° N, 7.585 ° E; ca 130 m a. s. l.; 20–27 Jun. 2017; ZFMK et al. leg.; Malaise trap; ZFMK -TIS-2629283 . • 1 ♀, 2 ♂♂; same collection data as for preceding 18–25 Jul. 2017; female - ZFMK -TIS-2629289; males - ZFMK -TIS-2629485, ZFMK -TIS-2629568 . • 2 ♂♂; Rhineland-Palatinate, Ahrweiler, Niederzissen, Bausenberg, slope of volcanic mountain, mixed broad-leaved forest; 50.4679 ° N, 7.2223 ° E; ca 330 m a. s. l.; 12–27 Jul. 2022; Santiago Jaume Schinkel leg.; Gressitt Malaise trap; ZFMK -HYM-00039687, ZFMK -HYM-00039688 . • 1 ♂; Rhineland-Palatinate, Ahrweiler, Niederzissen, Bausenberg, upper part of volcanic mountain, next to oak tree; 50.4672 ° N, 7.2212 ° E; ca 310 m a. s. l.; 12–27 Jul. 2022; Santiago Jaume Schinkel leg.; Gressitt Malaise trap; ZFMK -HYM-00039671 . • 1 ♂; Saxony, Leipzig, surroundings of Naunhof; 28 Jul. 1957; Michalk leg.; JV_Prel_0046 (SDEI) .

The Netherlands • 1 ♀; Gelderland, Beek-Ubbergen, Goudenregenstraat, garden; 51.8268 ° N, 5.9332 ° E; ca 10 m a. s. l.; 1 Oct. 2023; Jochem Kühnen leg.; hand caught; ZFMK -HYM-00039657 . • 1 ♂; Gelderland, Nijmegen, Gelderse poort; 10 May 2022; R. Lexmond leg.; Malaise trap; JV_Prel_0043 (RBINS) . • 1 ♀, 7 ♂♂; same collection data as for preceding 20 Jul. 2022; female - JV_Prel_0077 (RBINS); males - JV_Prel_0078 (RBINS), JV_Prel_0079 (RBINS), JV_Prel_0080 (RBINS), JV_Prel_0081 (RBINS), JV_Prel_0082 (RBINS), JV_Prel_0083 (RBINS), JV_Prel_0084 (RBINS) . • 1 ♀; same collection data as for preceding 23 Aug. 2022; JV_Prel_0060 (RBINS) .

Portugal • 1 ♂; Madeira, Funchal, Curral das Romeiros; ca 550 m a. s. l.; 8 Feb. 1991; Martti Koponen leg.; specimen in coll. Koponen.

Sweden • 1 ♂; Dalarna, Rättvik, Glostjärn; 20 May- 30 Jun. 1977; Tord Tjeder leg.; NHRS - HEVA 000023151 (NHRS) . • 1 ♀; Hälsingland, Älgesjön; 62.16 ° N, 16.212 ° E; ca 300 m a. s. l.; 17 May- 15 Jun. 2002; Erik Sahlin leg.; window trap; Tömn 1, specimen in coll MF . • 1 ♂; Närke; 10 Aug. 1953; Anton Jansson leg.; NHRS - HEVA 000023153 (NHRS) . • 1 ♂; Närke, Oset; 8 Aug. 1941; Anton Jansson leg.; NHRS - HEVA 000023152 (NHRS) . • 1 ♂; Öland, Kastlösa; 26 Jun. 1962; Karl-Johan Hedqvist leg.; NHRS - HEVA 000023175 (NHRS) . • 1 ♀; Öland, Mörbylånga kommun, Skogsby, Ecological research station, lawn in garden with sandy soil; 56.6283 ° N, 16.4918 ° E; ca 30 m a. s. l.; 29 Aug. - 11 Sep. 2008; Swedish Malaise Trap Project (Swedish Museum of Natural History) leg.; Malaise trap; NHRS - HEVA 000023174 (NHRS) . • 1 ♂; Östergötland, S: t Anna, Svensmarö, Sanningholmen; 7 Aug. 1976; Gustaf Wängsjö leg.; NHRS - HEVA 000023176 (NHRS) . • 1 ♂; Scania, Kristianstads kommun, Trunelän, Degeberga, Grazed meadow at alder stand along stream; 55.7746 ° N, 14.2156 ° E; ca 80 m a. s. l.; 1–13 Aug. 2019; Swedish Insect Inventory Programme (SIIP), Station Linné leg.; Malaise trap; NHRS - HEVA 000023155 (NHRS) . • 1 ♂; Scania, Malmö kommun, Klagshamn, Limhamns kalkbrott, Limestone quarry; 55.5694 ° N, 12.9267 ° E; ca - 50 m a. s. l.; 4–12 Jun. 2018; Swedish Insect Inventory Programme (SIIP), Station Linné leg.; Malaise trap; NHRS - HEVA 000023154 (NHRS) . • 2 ♂♂; Södermanland, Trosa kommun, Hunga södergård 1, agricultural backyard, heavily eutrophicated, in tall grass near stable manure pile; 58.9207 ° N, 17.5212 ° E; ca 20 m a. s. l.; 16 May- 13 Jun. 2004; Swedish Malaise Trap Project (Swedish Museum of Natural History) leg.; Malaise trap; NHRS - HEVA 000023156 (NHRS), NHRS - HEVA 000023157 (NHRS) . • 4 ♀♀, 3 ♂♂; same collection data as for preceding 9–19 Aug. 2004; females - NHRS - HEVA 000023158 (NHRS), NHRS - HEVA 000023160 (NHRS), NHRS - HEVA 000023161 (NHRS), NHRS - HEVA 000023164 (NHRS); males - NHRS - HEVA 000023159 (NHRS), NHRS - HEVA 000023162 (NHRS), NHRS - HEVA 000023163 (NHRS) . • 1 ♂; Södermanland, Väsbyön; 11 Aug. 1950; Anton Jansson leg.; NHRS - HEVA 000023165 (NHRS) . • 1 ♀; Uppland, Almunge, Harparbol; 20 Jun. 1948; Olov Lundblad leg.; NHRS - HEVA 000023169 (NHRS) . • 1 ♀, 1 ♂; Uppland, Älvkarleby, Båtfors, flood-regiment oldgrowth birch edge of pine forest; 60.4607 ° N, 17.3178 ° E; ca 40 m a. s. l.; 14 Jun. - 4 Jul. 2005; Swedish Malaise Trap Project (Swedish Museum of Natural History) leg.; Malaise trap; female - NHRS - HEVA 000023167 (NHRS); male - NHRS - HEVA 000023166 (NHRS) . • 1 ♂; Uppland, Håbo kommun, Biskops-Arnö, elm grove; 59.6721 ° N, 17.5009 ° E; ca 10 m a. s. l.; 27 Aug. - 10 Sep. 2004; Swedish Malaise Trap Project (Swedish Museum of Natural History) leg.; Malaise trap; NHRS - HEVA 000023168 (NHRS) . • 1 ♀; Uppland, Uppsala, Vårdsätra skog, forest; 7–28 Oct. 2002; Fredrik Ronquist leg.; Malaise trap; specimen in coll MF . • 2 ♂♂; Västerbotten, Hällnäs; 22 Aug. 1961; Karl-Johan Hedqvist leg.; NHRS - HEVA 000023170 (NHRS), NHRS - HEVA 000023171 (NHRS) . • 1 ♀; Västergötland, South of Alingsås; 29 Jul. 1998; Torkhild Munk leg.; NHRS - HEVA 000023172 (NHRS) . • 1 ♀; Västmanland, Sala kommun, Västerfärnebo, Nötmyran (Östermyran), birch stand in moist haymaking meadow; 59.942 ° N, 16.3095 ° E; ca 70 m a. s. l.; 18 Aug. - 1 Sep. 2003; Swedish Malaise Trap Project (Swedish Museum of Natural History) leg.; Malaise trap; NHRS - HEVA 000023173 (NHRS) .

Switzerland • 1 ♀; Neuchâtel, Montmollin; 1 Aug. 1966; Jacques de Beaumont leg.; specimen at MHNG . • 2 ♂♂; same collection data as for preceding 3 Aug. 1957; specimens at MHNG . • 1 ♂; same collection data as for preceding 17 Aug. 1962; specimen at MHNG . • 1 ♂; same collection data as for preceding 19 Aug. 1957; specimen at MHNG . • 2 ♂♂; same collection data as for preceding 31 Aug. 1956; specimens at MHNG . • 1 ♂; same collection data as for preceding 29 Sep. 1956; specimen at MHNG . • 1 ♀; St. Gallen, Pfäfers; 9 Sep. 1992; F. Amiet leg.; specimen at NMBE . • 1 ♀; Valais, Visperterminen; ca 1550 m a. s. l.; 4 Aug. 1996; Gerhard Bächli | Bernhard Merz leg.; specimen at NMBE . • 1 ♂; Vaud, Ferreyres; 8 Sep. 1964; Jacques de Beaumont leg.; specimens at MHNG . • 1 ♀; Vaud, Lausanne, Vidy; 9 Sep. 1948; Jacques Aubert leg.; specimens at MHNG . • 1 ♀; Vaud, Lutry; 18 Jun. 1954; Jacques Aubert leg.; specimens at MHNG . • 1 ♂; Vaud, Rougemont; ca 1000 m a. s. l.; 14 Jun. 1963; Claude Besuchet leg.; specimens at MHNG .

Biology.

Summer species, flying mainly from May to October, peak in July. Collected in all kinds of habitats: deciduous and coniferous forests, gardens, parks and orchards, agricultural fields, pastures and meadows, ruderal land, ponds and marshes

Distribution.

Verified by morphological examination: Belgium, Denmark, Germany (locus typicus of A. spheciformis; locus typicus of A. fergussoni: Ingelheim am Rhein), Lithuania, The Netherlands, Norway, Portugal, Sweden (locus typicus of A. eucharioides: Västergötland), Switzerland, United Kingdom (locus typicus of A. tincta: unclear, either near London, Isle of Wight or Machynlleth (North Wales)).

CO 1 barcode sequence matches: Belarus (e. g. GMBMQ 746-17) and Canada (e. g. BBHYJ 932-10).

Lowland species, usually occurring in elevations below 500 m a. s. l., rarely collected in higher altitudes, most specimens between 0–100 m a. s. l.

Remarks.

A. eucharioides is both the most commonly collected and the most morphologically heterogeneous species within the genus Anacharis . Specimens often exhibit slight metallic sheen on their mesoscutum and head that is more notable in ethanol-stored specimens but sometimes retains on dried specimens.

The type of A. eucharioides is reportedly lost (Fergusson 1986, Mata-Casanova et al. 2018), which we confirm herein by having searched the collection of the NHRS in addition to previous efforts at other possible depositories (NHMUK, MZLU). In the current situation with several new species, we disagree with Fergusson’s statement, that “ … there is no confusion about the identity of this species ” and that “ a neotype is not required ” (Fergusson 1986) and rather stress the necessity to designate a neotype from the broader type locality at Västergötland. However, as we were not able to acquire a fresh specimen suitable for DNA sequencing from the type locality, we withhold taking action until a more suitable occasion.

The lectotype of A. tincta is glued to its ventral side on cardboard, face down, the wings also glued to the board. It is overall intact, except the terminal four segments of the left antenna, which are detached from the rest to the specimen but still present on the cardboard. Also, the left fore tarsomeres are detached, the second tarsomere is missing, the rest is glued on the card. Both wings and legs obscure the lateral mesosoma on both sides. We here confirm the synonymy with A. eucharioides .

The lectotype of A. spheciformis (Hartig, 1840) was designated by Weld (1952), who reported the syntype series to consist of 12 specimens. Interestingly, Fergusson (1986) reports only one specimen under the name A. spheciformis from the Hartig collection, meaning that 11 syntypes might be lost. Fergusson additionally states the sex of the lectotype to be female, while the specimen is clearly a male. The species was treated as a synonym of A. typica by Dalla-Torre and Kieffer (1910) and Weld (1952), as established by Reinhard (1860), but the lectotype has a clearly sculptured mesoscutellum, which makes it distinct from A. typica . We agree with the latest treatments of A. spheciformis as synonym of A. eucharioides (Fergusson 1986; Mata-Casanova et al. 2018) but as we consider A. typica a valid species, we formally move it from synonymy with A. typica to A. eucharioides .

A. fergussoni is diagnosed against A. parapsidalis and A. melanoneura in Mata-Casanova et al. (2018). The reason why it is not considered similar to A. eucharioides by the authors is likely due to the distinction they make based on the parascutal sulcus (present in A. fergussoni, absent in A. eucharioides), as used in their key (couplet 3). As we found this character to be very variable within A. eucharioides, this is not sufficient for discrimination. The character states used to diagnose A. fergussoni against A. parapsidalis and A. melanoneura given by Mata-Casanova et al. (2018) match with the re-description of A. eucharioides by Mata-Casanova et al. (2018) and our observations. The morphometric values given for A. fergussoni fall into the range of A. eucharioides as diagnosed herein (Table 2), except the head width: length and the petiole length: metacoxa length which exhibit unusual high values in the description of A. fergussoni . However, the former is only 0.1 off of the range of A. eucharioides, and might well fall into the error range, and the latter (relative petiole length) seems erroneous in the description (“ about 2.0 times as long as metacoxa ” Mata-Casanova et al. 2018), as we measure a value of 1.4 on the images of the holotype, which falls well into the range of what we measured for A. eucharioides and is even close to the mean (1.0–1.7, mean 1.5). In terms of qualitative characters, the centrally sparsely pubescent to glabrous median lobe of the mesoscutum, the well-foveated notauli, the median carina of the mesoscutellum that is medially morphing into reticulate sculpture and the smooth to rugose lateromedial area of pronotum are typical for A. eucharioides . Based on this re-evaluation of possible morphometric differences and the similarity in qualitative characters between the specimens examined herein and the holotype of A. fergussoni we synonymise A. fergussoni with A. eucharioides .

We want to note that images of the holotype, kindly provided to kindly provided to us by the team at CNC, do not correspond to all the SEM images in Mata-Casanova et al. (2018, Fig. 4 A – C). Fig. 4 A clearly shows the holotype before the right wings were removed, as does fig. 4 B though the image is vertically flipped, but fig. 4 C shows a different antennal position and must be a different specimen.

Here, we demonstrate that, given the morphometric variability within A. eucharioides and the whole eucharioides species group, morphometric characters / analyses cannot reliably separate this species from the others (Fig. 8 A). Our diagnosis rather relies on qualitative characters and species delimitation has been crucially informed by the results from analysis of molecular sequence data, which show a distinct cluster / putative species with small intraspecific variability based on almost 300 specimens from various localities. Without this reverse taxonomy approach included, finding and defining species limits within the eucharioides species group, and especially of A. eucharioides would have been difficult if not impossible.

Additional distribution records are listed in Mata-Casanova et al. (2018) for Andorra, France, Romania, Spain, Slovakia and Hungary. Since our circumscription of A. eucharioides is narrower than that of Mata-Casanova et al. (2018), we cannot confirm the presence of the species in these countries (specimens listed as A. eucharioides could also belong to A. typica or A. petiolata) but it is likely present in these regions, too.